Labshake search
Citations for Qiagen :
501 - 550 of 2742 citations for 6 Bromo 4 5 dihydro 1H benzo b azepin 2 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Four hundred microliters of precipitation buffer B from the Qiagen (Formerly, Exiqon) miRCURY Exosome Isolation Kit (Qiagen, Germantown, MD) was added to the supernatant in each tube ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was discarded and 3.5 ml of RLT buffer with B-mercaptoethanol (10 µl for every 350 µl of RLT buffer – Qiagen) was added ...
-
bioRxiv - Genetics 2020Quote: Total genomic DNA of the tigecycline-resistant isolate was extracted by Puregene Yeast/Bact Kit B (Qiagen, Maryland, US), and was sequenced by using Hiseq 4000 system (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... Gene ontology analyses for high affinity/SHM class-specific GC B cells were performed with Ingenuity Pathway Analysis (Qiagen) software using avg_logFC values of all genes significantly enriched in at least one class ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA from primary B cells treated with sg05 RNPs was isolated using the DNeasy Blood & Tissue Kit (Qiagen) and amplified for sequencing by nested PCR using Platinum SuperFi II Master Mix (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... and GFP+Ly5.1+ (OCA-B-expressing) cells were sorted by FACS and used for RNA purification (RNeasy Mini Kit, QIAGEN). RNA concentrations were determined using a Quant-iT RNA assay kit and a Qubit fluorometer (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... GC B cells (Live/Dead-CD19+IgD-CD95+GL-7+) and naïve B cells (Live/Dead-CD19+IgD+) were flow sorted into RLT Plus buffer (Qiagen) following pre-enrichment with the Pan B Cell Isolation Kit II (Miltenyi) ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: SUZ12 isogenic M3 MPNST cells were treated with or without DNMT inhibitors (50 nM daily Decitabine or 4 μM single dose of GSK862) for 4 days followed by genomic DNA isolation with Gentra Puregene cell kit (Qiagen). Bisulfite sequencing was conducted by the IGO core facility at MSKCC ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from infected (n = 4) and control (n = 4) bAM samples using the RNeasy Plus Mini Kit (Qiagen) as previously described [91] ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Molecular Biology 2021Quote: ... or 6 µM and harvested 24 h later by adding RLT lysis buffer (Qiagen). Similarly ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue from 6 brains were pooled to prepare total RNA (RNEasy micro kit, Qiagen) for reverse transcription and amplification to cDNA (Ovation Pico WTA kit ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and harvested for RNA extraction after 6 hours of incubation using RNAeasy kits (Qiagen). cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: HEK293Ts were plated in 6 well plates and transfected using Effectene Transfection Reagent (Qiagen) according the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Biophysics 2023Quote: TSA measurements were carried out on a Rotor-Gene Q 6 plex (Qiagen, Germany) instrument at a heating rate of 2 °C/min and a temperature range of 25−90 °C in the presence of a CPM dye ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 nM siRNAs were mixed with 6 µl of HiPerFect transfection reagent (Qiagen, #301707) in 100 µl of serum free DMEM and added to freshly plated cells drop by drop ...
-
bioRxiv - Genomics 2022Quote: ... After overnight proteinase K digestion in Lysis Buffer (Bionano Genomics) and one hour treatment with RNAse A (Qiagen), plugs were washed four times in 1x Wash Buffer (Bionano Genomics ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was extracted from overnight cultures issued from one isolated colony following standard protocols (QIAGEN DNAeasy, Hilden, Germany). As controls ...
-
bioRxiv - Cell Biology 2021Quote: One µg of total RNA extracted from ELT3-V cells with the RNeasy Mini Kit (Qiagen, Germantown, MD) was reverse-transcribed into cDNA using amfiRivert cDNA Synthesis Master Mix (GenDEPOT ...
-
bioRxiv - Plant Biology 2021Quote: ... Sets of 95 ligations were pooled into one sample and purified using QIAquick PCR Purification Kit (Qiagen, Germany). The pooled ligation mixtures (5 μL ...
-
bioRxiv - Microbiology 2022Quote: ... the bacterial assemblage genomic DNA was extracted from one g of beads using DNeasy PowerSoil Pro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... complementary DNA strand was synthesized from one μg of total RNA using QuantiTect® reverse transcription kit (Qiagen). Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad ...
-
bioRxiv - Pathology 2019Quote: ... RNA was extracted from PRRSV and one replicate of CDV using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The quantitative real-time TaqMan based assay was carried out using a One-step RT-PCR kit (Qiagen) in the Light Cycler 2.0 system (Roche) ...
-
bioRxiv - Genetics 2021Quote: Long PCR products were purified by gel electrophoresis and short ones with the QIAquick PCR purification kit (Qiagen). Terminal adenine overhangs were added using Taq polymerase in the presence of dATP ...
-
bioRxiv - Genetics 2020Quote: ... reverse primers 852Rb-AGGAAGATAGAGAAAGAGCAACC and 852Rc-AGGAAGATAGAAAAGGAGCAACC using QIAGEN One-Step RT-PCR kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5μL of the resulting DNA underwent one or more displacement amplifications using the Repli-G MDA kit (Qiagen), to enrich microbial DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... One microgram of genomic DNA was bisulfite converted with the EpiTect® Fast 96 DNA Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA extraction was carried out using one of the following methods: 1) QIAmp DNA Mini Kit (Qiagen, Germany); 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... One hour of tagmentation at 37°C was followed by DNA extraction using MinElute PCR Purification Kit (Qiagen). Extracted DNA was subjected to PCR amplification using unique primers sets (Nextera XT v2 Full set (N7-S5)) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase Inhibitor (4 unit/µl) (cat # 1055213, Qiagen), rRNasin Rnase inhibitor (40 U/µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4) DNeasy Plant Mini Kit (QIAGEN®) combined with the InhibitEx Buffer step from the QIAamp DNA Stool Mini Kit to improve inhibitor removal ...
-
bioRxiv - Microbiology 2019Quote: ... 4 µg/mL DNase I (QIAgen, Hilden, Germany), 2 µg/mL RNase A (QIAgen) ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of 100 mg/mL RNase (Qiagen) was added ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen): cDNA ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Immunology 2021Quote: RNA was prepared from sorted GC B cells and LNPCs from FNA or enriched BMPCs from bone marrow using the RNeasy Plus Micro kit (Qiagen). Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNAs of tet(X)-positive isolates were extracted by using Puregene Yeast/Bact Kit B (Qiagen, Gaithersburg, MD, Germany) according to the instruction of the manufacture ...
-
bioRxiv - Microbiology 2022Quote: ... Cytochrome b products were excised and purified from the gel using a commercial kit (QIAquick Gel Extraction Kit, Qiagen, Germany), followed by purification of eluted DNA using AMPure XP Magnetic Beads (1X ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...