Labshake search
Citations for Qiagen :
351 - 400 of 1201 citations for 5 SULFOPICOLINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... proteins were expressed in Escherichia coli strain BL21 (DE3) and purified via nickel-nitrilotriacetic acid affinity chromatography (Qiagen) followed by ion exchange chromatography on an Äkta system (GE Healthcare) ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... or from 1 mL plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN, Cat. No.: 55114, QC for short) following the manufacturer’s guide ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 mL of plasma were thawed and cfDNA extracted using the QIAamp® Circulating Nucleic Acid Kit (Qiagen) according to the manufacturer’s protocol and stored at −20°C until use ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with 12.5 or 6.25nM locked nucleic acid (LNA) miRNA inhibitors (miR-194 LNA inhibitor or negative control inhibitor; Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acids were extracted using QIAamp 96 virus Qiacube HT kit on QIAxtractor Automated extraction (Qiagen, US) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Nucleic acids were isolated via chloroform extraction and RNA was isolated with the Qiagen RNEasy Mini (Qiagen #74104) including on-column DNase I digestion ...
-
bioRxiv - Plant Biology 2020Quote: ... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted from 140 ul of sample fluid using the QIAamp RNA Viral kit (Qiagen) and eluted with 30 ul of DEPC-treated water ...
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were extracted from mouse fecal samples and inoculum samples using the DNeasy Powersoil HTP Kit (QIAGEN) and from the further simplified SC2 samples using the Powermag Microbiome kit (MoBio) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5% deoxycholic acid with a protease inhibitor) and pre-cooled tissue homogenizer (TissueLyser LT, Qiagen GmbH, Hilden, Germany) for 2-4 min at 45 Hz ...
-
bioRxiv - Microbiology 2019Quote: ... followed by a standard nucleic acid extraction method using QIAamp genomic DNA Mini Kit (Qiagen Sciences, Maryland, USA), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from up to 500 μl of plasma using QIA amp Circulating Nucleic Acid Kit (Qiagen) and eluted in 15 μl volume ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA was isolated from 2 ml of plasma using either the manual QIAamp circulating nucleic acid kit (Qiagen), or the semi-automated QIAsymphony DSP Circulating DNA Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 700 μl of the supernatant was mixed with 30 μl of nickelnitrilotriacetic acid-agarose (Ni-NTA, Qiagen) for 2 h at RT with mild rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... and the soluble fraction of the lysate was incubated with Ni2+-nitrilotriacetic acid (NTA) beads (Qiagen, Hilden, Germany). Proteins were eluted with 300 mM imidazole in 60 mM NaH2PO4 ...
-
bioRxiv - Microbiology 2023Quote: Total nucleic acids were extracted from half of each sample’s O.2μm filter using DNAeasy PowerSoil Kit (Qiagen). Extraction blanks were run with each round of DNA extractions and all returned no detectable nucleic acids using the maximum amount of blank sample (20μL ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was filtered through a 0.45 μm filter and loaded on a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Neuroscience 2023Quote: ... Deoayribonucleic acid (DNA) was extracted from stored buffy coat using the Blood Mini DNA kit (Qiagen, Valencia, CA). A TaqMan® single nucleotide polymorphism (SNP ...
-
bioRxiv - Microbiology 2023Quote: ... Viral nucleic acids were extracted using the QIAMP® Viral RNA mini kit (60 µL, Qiagen, Venlo, Netherlands) without the addition of carrier RNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... we added a 5-mm stainless steel bead (QIAGEN) and 100 μl of PBS to each tube and lysed the samples by TissueLyser II (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg total RNA was treated with DNase (Qiagen) and purified (RNeasy Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... A single sterile 5 mm stainless steel bead (Qiagen) was added to each tube ...
-
bioRxiv - Neuroscience 2022Quote: ... and added 5 volume PB including pH-indicator (Qiagen) and 200 μL sodium-acetate (3M ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 µl Hot Start Polymerase (Qiagen, 5 U/ µl), 20 ng/µl DNA template (95°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... siWDR1 (5’-GGTGGGATTTAGGCAATTATT) and AllStars Negative Control siRNA (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of Taq PCR Master Mix kit (Qiagen), 0.4 μl of each primer (100 pmol/μl ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... A 5 ml Strep-tactin Superflow Plus column (Qiagen) was equilibrated with 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 5 mm diameter stainless steel bead (Qiagen) for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations ...
-
bioRxiv - Immunology 2021Quote: ... Plates contained 5 µl of TCL lysis buffer (Qiagen) supplemented with 1%β-mercaptoethanol ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Genomics 2021Quote: ... 5 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a 5 mm stainless steel bead (Qiagen #69989) in an RNase-free microcentrifuge tube ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5 mm stainless steel beads (QIAGEN Cat#69989). To these tubes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 µl SYBR Green Mix (Qiagen N.V., Venlo, Netherlands), and 3 µl nuclease-free water (total volume ...
-
bioRxiv - Physiology 2023Quote: ... and homogenized using 5-mm steel beads (Qiagen #69989) in a bead mill (Qiagen TissueLyser LT) ...
-
bioRxiv - Microbiology 2023Quote: ... 5×105 cells were lysed in RLT buffer (QIAGEN) with 10 μL of β-mercaptoethanol ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2019Quote: ... and the supernatant was subjected into 9+ 9_ļ_ Ni2+ -nitrilotriacetic acid (Ni2+ -NTA) agarose resin (Qiagen, Valencia, CA, USA) for affinity chromatography purification ...
-
bioRxiv - Biochemistry 2019Quote: ... Acid-phenol based method was used to isolate total RNA and then purified using RNAeasy mini kit (Qiagen,USA) after a DNAse treatment (TURBO™ DNase ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...