Labshake search
Citations for Qiagen :
301 - 350 of 1201 citations for 5 SULFOPICOLINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Developmental Biology 2020Quote: Nucleic acid material remaining in ECM preparations was isolated using a DNeasy Blood & Tissue Kit (Qiagen, Germany). The amount of DNA was quantified using Qubit Fluorometric Quantification.
-
bioRxiv - Molecular Biology 2019Quote: ... and the soluble fraction was loaded onto a column packed with Ni(II)-nitrilotriacetic acid agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Immunology 2019Quote: ... anticoagulant ethylenediaminetetraacetic acid (EDTA) and DNA was extracted from peripheral blood mononuclear cells through commercial kits (Qiagen GmbH ...
-
bioRxiv - Microbiology 2019Quote: ... PhoPEcl-His8X was purified on a Ni-nitrilotriacetic acid (NTA) beads according to the manufactures instructions (Qiagen).
-
bioRxiv - Bioengineering 2021Quote: The soluble fraction of the cell lysate was mixed with Ni2+-nitrilotriacetic acid agarose beads (Qiagen, USA), and the His6-tagged recombinant proteins were purified by immobilized metal affinity chromatography (IMAC ...
-
Structural Basis for SARS-CoV-2 Envelope Protein in Recognition of Human Cell Junction Protein PALS1bioRxiv - Biochemistry 2021Quote: ... the supernatant was collected for affinity purification by nickel-nitrilotriacetic acid affinity chromatography (Ni-NTA, Superflow, Qiagen). The eluate was concentrated and buffer exchanged for tag removal by incubation with TEV protease overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleic acid was extracted from cell culture media manually using a QIAamp Viral RNA Mini Kit (QIAGEN) or using NucliSENS easyMAG or EMAG platforms (both BioMérieux) ...
-
bioRxiv - Microbiology 2021Quote: RNA was purified by acid phenol-chloroform extraction and column purified (RNeasy mini kit QIAGEN REF 74104) from HFFs grown in media with or without Pan and/or infected with wild-type RH parasites (grown in regular or Pan-depleted media) ...
-
bioRxiv - Microbiology 2020Quote: ... using the MagAttract 96 cador Pathogen Kit in a BioSprint 96 nucleic acid extractor (Qiagen, Hilden, Germany), according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: DNA was extracted from 200-400 μL of plasma with the QIAamp Circulating Nucleic Acid Kit (QIAGEN). DNA extraction was performed in batches of 24 ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid extractions were performed by combining equal amounts of Lysis Buffer RLT (Qiagen, Germantown, MD, USA) with supernatant from clinical samples (swabs ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid extractions were performed by combining equal amounts of Lysis Buffer RLT (Qiagen, Germantown, MD, USA) with supernatant from clinical samples (swabs ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from supernatants and pellets using the QIAamp Viral RNA Mini Kit (52906, Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... https://www.beiresources.org/).Protein was purified using gravity flow purification with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen, Germany) and concentrated and buffer exchanged in Amicon centrifugal units (EMD Millipore ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cell-free DNA was extracted from maternal plasma with QIAamp Circulating Nucleic Acid Kit (Qiagen, Dusseldorf, Germany). The cell-free DNA library was prepared using the KAPA Library Preparation Kit (Kapa Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Total nucleic acid was extracted from 100 μl of supernatant using the QIAamp viral RNA kit (Qiagen) eluting in 50ul of H2O ...
-
bioRxiv - Molecular Biology 2020Quote: The MS2 RNA was purified from the phage particles using QIAamp Circulating Nucleic Acid Kit (Qiagen, Germany) accordingly to the manufacturer’s protocol and stored at −80°C.
-
bioRxiv - Biochemistry 2019Quote: ... Expressed protein was purified by elution from a nickel-nitrilotriacetic acid agarose (Ni-NTA) (Qiagen, Germantown, MD) column with 0.5 M imidazole and buffer exchanged into TEV buffer (25 mM NaHPO4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MBP eluate was then incubated with pre-equilibrated nickel-nitriloacetic acid resin (Ni-NTA agarose, Qiagen) for 60 mins in the presence of 20 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: Locked Nucleic Acids (LNA) and miRNA mimics and scrambled LNA/mimic (negative control) was purchased from Qiagen and MOLM13 cells were transfected with either LONZA nucleofector devise (program X-001 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... 24 and 48 hours and nucleic acid extracted using Qiamp viral RNA mini extraction kit (Qiagen, #52904). Viral DNA levels were quantified by qPCR using primers and probe that detect the ASFV VP72 gene52 with the Quantifast Pathogen PCR kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from brain regions was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Microbiology 2021Quote: ... and supernatants were collected for affinity purification over pre-equilibrated nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) columns ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 and 0.1 μg) were allowed to bind 30 μl of nickel-nitrilotriacetic acid-agarose beads (QIAGEN) for 1 hour after which unbound decoy was removed by washing with PBS ...
-
bioRxiv - Microbiology 2022Quote: Viral nucleic acids were extracted with the QIAamp® Viral RNA Mini Kit (Qiagen, GmbH, Hilden, Germany) from 140 μl of culture supernatants collected following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The subsequent isolation of nucleic acids was performed using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids (both RNA and DNA) were extracted with the QIAamp Viral RNA Minikit (Qiagen; CA).
-
bioRxiv - Developmental Biology 2023Quote: ... DNA from brain regions was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The cleared lysate was then mixed with nickel-nitrilotriacetic acid (Ni-NTA)-agarose beads (QIAGEN, Hilden, Germany) or glutathione (GSH ...
-
bioRxiv - Cancer Biology 2023Quote: ... The diluted plasma was recovered and processed for cfDNA isolation by QIAmp Circulating Nucleic Acid kit (Qiagen) [16].
-
bioRxiv - Microbiology 2023Quote: ... and nuclease treated prior to viral nucleic acid extraction with the QIAamp viral RNA mini kit (Qiagen) (Chong et al. ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acid was extracted from the supernatant using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions with modifications ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from all samples (5 CTRL and 5 SCZ subjects at six timepoints across astrocyte differentiation) using either the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) or the MagMax mirVana Total RNA Isolation Kit (Thermo Fisher) ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.1 g of tissue per 1 mL of PBS was homogenized with stainless steel beads of 5 mm (25–30 Hz for 5 min) by a Tissuelyser (Qiagen, Venlo, Netherlands). The homogenates were centrifuged at 10,000 x g for 10 min and the supernatant was collected and stored at −80 °C until CD quantification ...
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Microbiology 2024Quote: ... IFAS and LifeGuard Soil Preservation were transferred into a 5 mL bead beating tube from DNeasy PowerWater kits for 5-minutes of vortexing (Qiagen, Hilden, Germany). Afterwards ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...