Labshake search
Citations for Qiagen :
1 - 50 of 857 citations for 5α CHOLESTAN 3 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RLT buffer (QIAGEN) and RNA was isolated according to the manufacturer’s instructions (RNeasy Plus Micro Kit ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA from the original material used for next-generation sequencing of the serum and passage 3 cultured MRI103 virus was used as the template for amplification using the One-Step Ahead RT-PCR kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: ... and organoids at the end of passage one subjected to two weeks of differentiation (n=3) using the RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... we added 500 μL of TRIzol and one 3-mm glass bead to the microtubes with mosquitoes and then homogenized the samples in a TissueLyser® (QIAGEN, Hilden, Germany) at 30 Hz for 3 min ...
-
bioRxiv - Immunology 2023Quote: Whole livers were harvested at indicated timepoints and placed into a 7 ml homogenizer tube (Omni International Cat. No. 19-651) containing 3 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Spleens and single granulomas were harvested at indicated timepoints and placed into a 1 ml homogenizer tube (Fisher Brand Cat ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Genomics 2022Quote: ... One mL of Qiazol (Qiagen) was added to an aliquot of 150 μl of plasma per sample ...
-
bioRxiv - Immunology 2023Quote: ... One stainless steel bead (Qiagen) was added per sample and liver tissues were homogenized using the TissueLyser LT (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Barcoded libraries (One-step, Qiagen) were then run on MiSeq or NextSeq Illumina sequencers ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Immunology 2023Quote: ... Subsequent one-step RT-PCR (Qiagen) was performed using gene-specific primers listed in Supplementary Table S2.
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Barcoded libraries were made (One-step, Qiagen) and run on MiSeq or NextSeq Illumina sequencers ...
-
bioRxiv - Genetics 2019Quote: ... One-Step RT-PCR reagent (Qiagen # 210212) was used to create cDNA and then the cDNA was amplified by PCR ...
-
bioRxiv - Microbiology 2022Quote: One-Step Probe RT-qPCR kits (Qiagen) and CFX96 system/software (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... with one on-column DNase treatment (Qiagen). Total RNA yield was quantified using a Nanodrop (Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: One-Step Probe RT-qPCR kits (Qiagen) and CFX96 system/software (BioRad ...
-
bioRxiv - Physiology 2024Quote: ... one 3mm Tungsten carbide bead (69997, Qiagen) was added to each tube ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Microbiology 2020Quote: ... using One Step RT-PCR kit (Qiagen, Germany) and its larger portion was amplified for phylogenetic analysis by self designed primers ...
-
bioRxiv - Biochemistry 2021Quote: ... one 5mm stainless steel tissue homogenizer bead (Qiagen) was added to each tube ...
-
bioRxiv - Microbiology 2021Quote: ... with one-hour in-tube DNase digestion (Qiagen) to remove possible DNA contamination according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... in one-step probe RT-qPCR kits (Qiagen) with the following cycle conditions ...
-
bioRxiv - Microbiology 2020Quote: ... in one-step probe RT-qPCR kits (Qiagen) with the following cycle conditions ...
-
bioRxiv - Microbiology 2021Quote: ... in one-step probe RT-qPCR kits (Qiagen) with the following cycle conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... QuantiTect SYBR Green qRT-PCR one-step kit (Qiagen) was used to quantify ASALV with previously established primers (Hermanns et al. ...
-
bioRxiv - Microbiology 2021Quote: ... QuantiTect SYBR Green qRT-PCR one-step kit (Qiagen) was used to quantify ASALV with previously established primers (Hermanns et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μl 5x One-step RT-PCR buffer (Qiagen), 10 μl Triton-x100 (0.3%) ...
-
bioRxiv - Genomics 2020Quote: RNA was extracted using one of three kits (Qiagen QIAamp Viral RNA Mini kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with the Biosprint One-for-all Vet Kit (Qiagen) using a modified version of the manufacturer’s protocol as described previously (11) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with a mixture of one 2.8 mm ceramic (Qiagen), five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Microbiology 2023Quote: ... using a QIAcuity One Digital PCR System (Qiagen®). PCR conditions were 2 min at 95°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The blood samples from the 2020 FMD outbreak were analysed using a one-step PCR assay using the QIAGEN One-step RT-PCR Kit (Qiagen GmbH, Hilden, Germany) following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the One Step RT-PCR kit (Qiagen, Hilden, Germany) for RHDV2 ...
-
bioRxiv - Microbiology 2021Quote: ... The one-step QuantiTect SYBR Green RT-PCR kit (Qiagen) was used to synthesize the cDNA and perform qPCR under the following conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... One hundred fifty microliters of Ni-NTA agarose (QIAGEN, Germany) was loaded into Micro Bio-Spin Chromatography Column (0.8 mL bed volume ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the QIAGEN One-Step RT-PCR Kit (QIAGEN, Hilden, Germany) in 50 μl reactions containing 10 μl 5x QIAGEN OneStep RT-PCR Buffer ...