Labshake search
Citations for Qiagen :
401 - 450 of 2438 citations for Nnn Unlabeled 2 Mg Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Approximately 200 mg of contents were homogenized using TissueLyser II (QIAGEN) in 900 uL of 50 mM sodium acetate (pH 124 = 5.5 ...
-
bioRxiv - Microbiology 2019Quote: samples (∼30 mg) were homogenized utilising a TissueLyser LT (Qiagen, Germany) in 500 μl of phosphate buffer (0.2 M ...
-
bioRxiv - Cancer Biology 2023Quote: ... eight-ten mg of tumor were homogenized with TissueLyser II (Qiagen) in buffer RLT and transferred in a column for RNA isolation and DNA digestion ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from the remaining 2 mL of the cell suspension using the RNeasy® Protect Bacteria Mini Kit (QIAGEN, Cat. No. 74524) following the manufacturer instructions.
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from U87-MG using RNeasy Mini Kit (Qiagen) as instructed by the manufacturer after 72h treatment ...
-
bioRxiv - Physiology 2022Quote: ... and 25 mg of the macerate was homogenized in TissueLyser II (QIAGEN) at the highest speed for 1 min using 5 mm tungsten beads in 500 μL of methanol-chloroform-water solution (3:1:1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Microbiology 2019Quote: ... 9 mL 1M Tris HCl pH 7.5, 9 mL 0.5M EDTA pH 8.0, 11.25 mL 10% SDS, 22.5 mL Qiagen lysis reagent ...
-
bioRxiv - Neuroscience 2019Quote: ... 30 mg of pulverized tissue was homogenized in RLT lysis buffer (Qiagen, 74134). RNA was extracted using Qiagen RNAeasy plus kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: Total RNA was isolated from 10-20 mg heart tissue (RNeasy kit, Qiagen) of PN and AH mice (n≥6 in each group) ...
-
bioRxiv - Plant Biology 2021Quote: The samples (100 mg) were powdered using a TissueLyser II (Qiagen, Hilden, Germany). The powdered samples were used to quantify the starch ...
-
bioRxiv - Plant Biology 2020Quote: ... Up to 50 mg of plant material was lysed with buffer RLT (Qiagen) followed by protein removal with chloroform:isoamyl alcohol (24:1 ...
-
bioRxiv - Systems Biology 2019Quote: 25 mg of adipose tissue from mice were lysed in QIAzol reagent (Qiagen) using a tissue lyser to disrupt the tissue ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from 15-20 mg quadriceps using TRIzol (Qiagen, USA). One mL TRIzol was added to all samples and homogenized with stainless steel grinding balls for 2 minutes at 30 Hz using a TissueLyser II bead mill (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... dried plant tissue (20–30 mg) was ground using a TissueLyser II (Qiagen) with tungsten carbide beads for simultaneous disruption and homogenization of the sample ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 mg tissue was processed using the Blood and Tissue DNeasy kit (QIAGEN). 100 ng DNA was used for TaqManTM PCR quantification with transgene-specific probe/primer sets normalized to the TERT gene (Supplementary Table 2).
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Bioengineering 2020Quote: ... Around 250 mg of cooked sample was processed with DNeasy PowerSoil Pro Kit (QIAGEN). qPCR was performed using primers BT-1F and BT-1R (Table S3 ...
-
bioRxiv - Cancer Biology 2021Quote: Thymus tissues weighing 10-30 mg were homogenized using an electronic tissue disruptor (Qiagen) in ice-cold 80:20 methanol:water (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... 50 mg of flash-frozen tissue was homogenised in 700 μl of Qiazol (Qiagen) using a TissueRuptor II (Qiagen) ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA was extracted from < 20 mg of tissue using RNEasy Plus Mini Kit (Qiagen), including DNAse treatment ...
-
bioRxiv - Plant Biology 2021Quote: ... and ∼130 mg of roots for the DNeasy Plant DNA Extraction Kit (Qiagen, Germany) (Lay et al. ...
-
bioRxiv - Microbiology 2019Quote: ... genomic DNA was extracted from these 100-mg samples with a QIAcube instrument (Qiagen). The resultant DNA from each soil sample was eluted in 50 µL elution buffer included in the PowerSoil kit ...
-
bioRxiv - Physiology 2022Quote: ... approximately 100 mg frozen adipose tissue was homogenized in QIAzol buffer (Qiagen, Hilden, Germany) using Tissue Lyser (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... and ~130 mg of roots for the DNeasy Plant DNA Extraction Kit (Qiagen, Germany) (Lay et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissue (30 mg) was then homogenized with 1.4 mm ceramic beads (Qiagen; 13113-325) and lysed with RLT buffer from RNeasy Mini-Kit in a Precellys 24 (Bertin Technologies) ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 100 mg samples using the RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... 100 mg of biomass was used to isolate total RNA by RNAeasy kit (QIAGEN) NanoDrop and BioAnalyzer 2100 (Agilent Technologies Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... elastase (3.125 U/mL, Serva) and DNAse (17 U/mL, Qiagen) for 20 min at 37°C while shaking (750 rpm) ...
-
bioRxiv - Cancer Biology 2024Quote: ... doxycycline was added at (0.1 μg/ml, 1 μg/ml (CHRDL2 +) or 10 μg/ml (CHRDL2 ++) RNA was extracted (RNeasy, QIAGEN) and quantified by real-time reverse transcriptase polymerase chain reaction (qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 100 mg plant material using the RNeasy plant mini kit (Qiagen). RNA was checked and sequenced according to (Brilhaus ...
-
bioRxiv - Plant Biology 2020Quote: ... About 100 mg frozen plant material were pulverized in a tissue lyser (Qiagen, Hilden, Germany) at 30 Hz for 90 sec ...
-
bioRxiv - Neuroscience 2020Quote: ... Powdered tissue (∼5 mg) was dissolved in lysis buffer provided by RNeasy micro kit (Qiagen), supplemented with 1% (v/v ...
-
bioRxiv - Plant Biology 2020Quote: 20 mg of tissue was ground in liquid nitrogen using TissueLyser II (QIAGEN, Manchester, UK) and RNA extracted using the Qiagen ReliaPrepTM RNA Tissue Miniprep System ...
-
bioRxiv - Plant Biology 2021Quote: Tissues (100 mg) were homogenized into powders using a TissueLyser II (Qiagen, Valencia, CA, USA). DNA was extracted using the DNeasy Plant kit (Qiagen) ...