Labshake search
Citations for Qiagen :
451 - 500 of 2438 citations for Nnn Unlabeled 2 Mg Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from 20 - 40 mg fecal matter using the QIAamp Powerfecal Kit (Qiagen). The library preparation and sequencing was performed by the Host Microbe Systems Biology Core at UC Davis using primer pair 341F and 806R in 300 bp paired-end run for the V3-V4 hypervariable regions of the 16S rRNA on an Illumina MiSeq (Illumina ...
-
bioRxiv - Zoology 2020Quote: ... 15 mg of faeces using the DNeasy Blood and Tissue Kit (QIAgen GmbH, Hilden, Germany) following the maker’s guidelines with a small modification as explained by Shehzad et al ...
-
bioRxiv - Neuroscience 2019Quote: ... Total RNA was isolated from about 50 mg of sample using RNeasy mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted from ±100 mg ground tissue using the RNeasy Plant Mini Kit (Qiagen). Four biological replicates ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from 250 mg of hyphal aggregates using the DNeasy PowerSoil kit (Qiagen). We added 350 ng of 13C- and 12C-hyphosphere hyphosphere DNA (n = 3 each ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50-100 mg were first homogenized in a glass homogenizer (TissueRuptor II - Qiagen, Cat.9001272).
-
bioRxiv - Plant Biology 2023Quote: Total RNA was isolated from 100 mg Arabidopsis seedlings using RNeasy Plant Mini Kit (Qiagen). DNase treatment and cDNA synthesis was carried out using QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from 250 mg soil using DNeasy PowerSoil kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... RNA isolation was performed from 30 mg using the RNeasy Micro Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... approximately 50 mg of snap frozen placenta tissue was lysed in RLT-lysis buffer (Qiagen), and RNA was extracted using the RNeasy Mini kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cleared lysate was applied to a 20 ml disposable gravity-flow column 1.5 ml (0.75 ml bed volume) of NI-NTA agarose (Qiagen cat. #30210), washed twice in three bed volumes of Lysis Buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I and 200 µg/mL RNase A (Qiagen). Followed by a mild sonication (10 strokes ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of Ni-NTA agarose resin (Qiagen, 0.5 mL bed volume) was equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.7 ml Qiazol (Qiagen) was added to each dish and the lysate was collected into Qiashredder tubes (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... Viral RNA from 30 mg tissue samples was extracted with the RNeasy Plus Mini kit (Qiagen), and vRNA from swab samples was extracted with the QIAamp Viral RNA Mini kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 16 mg of total cell extract (TCE) were incubated with 320 μL of NiNTA beads (Qiagen) at 4 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was extracted from 50 mg of foetal frontal cortex using the RNeasy Mini kit (Qiagen) and subjected on-column incubation with RNase-free DNase according to manufacturer’s protocol (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 25 mg of pectoral muscle with a Qiagen DNeasy Blood and Tissue Kit (Qiagen; Hilden, Germany) and quantified DNA concentration using a Qubit 2.0 fluorometer (Life Technologies Corporation ...
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: RNA was extracted from 30 mg frozen tissue using the RNeasy Fibrous Tissue Mini Kit (Qiagen) as described by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 100 mg root material using RNEasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA from 200 mg feces was extracted using MoBio Powerfecal DNA kit (Qiagen, Valencia, CA) per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: Approximately 20 mg of pollen grains were ground into fine powder using a TissueLyser II (Qiagen), 5-6 Zirconox beads (2.8 to 3.3 mm ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 250 mg of each soil sample using the DNeasy PowerSoil kit (Qiagen). Illumina metagenomic DNA libraries were prepared and sequenced (150 bp single-end reads ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was extracted from 100 mg of powdered tissue using the RNeasy Plant Mini Kit (Qiagen) including DNAse treatment ...
-
bioRxiv - Physiology 2022Quote: ... approximately 150-200 mg of snap frozen placenta tissue was lysed in RLT-lysis buffer (Qiagen) with homogenization aided by a tissue-lyzer ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1 mg of RNA was reverse transcribed to cDNA using the Omniscript RT Kit (Qiagen). qPCR was performed using the TaqMan assay system ...
-
bioRxiv - Physiology 2021Quote: Approximately 20 mg of frozen muscle tissue was homogenized using a TissueLyser II (Qiagen, Valencia, CA) in an ice-cold lysis buffer (1:20 w/v ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was extracted from 100 mg biological material using the RNeasy Plant Mini Kit (Qiagen), extraction buffer RLC was supplemented with 2% PEG8000 ...
-
bioRxiv - Molecular Biology 2019Quote: Approximately 20 mg of frozen muscle tissue was homogenized using a TissueLyser II (Qiagen, Valencia, CA) in a 1:20 dilution of ice-cold RIPA buffer (pH 7.4 ...
-
bioRxiv - Microbiology 2019Quote: ... 50 mg of the powdered material was processed with the RNeasy Plant Mini kit (Qiagen, 74904) according to the manual and including an on-column DNase I digestion (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: Cecal DNA was extracted from ~30-200 mg samples using the DNeasy PowerSoil Pro Kit (Qiagen). The concentration of extracted DNA was measured with a NanoDrop Lite (Thermo ...
-
bioRxiv - Physiology 2022Quote: ... approximately 50 mg of snap frozen fetal liver tissue was lysed in RLT-lysis buffer (Qiagen) with homogenization aided by a tissue-lyzer ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated from ~10 mg frozen tissue using the DNeasy Blood & Tissue Kit (Qiagen).
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from 20-30 mg heart tissue (QIAshredder and RNeasy Mini Kit, Qiagen) and eluded in 20 µL RNase-free water ...
-
bioRxiv - Neuroscience 2023Quote: ... Precellys tubes were prefilled with 600 mg of ceramic beads (1.4 mm, Qiagen, cat. no 1103955) to facilitate metabolite extraction ...
-
bioRxiv - Physiology 2024Quote: Approximately 150–200 mg of placenta tissue was lysed and homogenized in RLT-lysis buffer (Qiagen) using a tissue homogenizer ...
-
bioRxiv - Microbiology 2024Quote: Total RNAs were extracted from 100 mg of plant tissue using RNeasy Plant Mini Kit (Qiagen). One μg of total RNA was used for northern blot analysis using two ToANV probes (+ and – strand ...
-
bioRxiv - Neuroscience 2024Quote: ... total RNA was extracted from 100–200 mg of tissue using RNeasy plus universal kit (QIAGEN), and reverse transcription was performed with Quantitect kit (QIAGEN) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I (AppliChem) and 200 µg/mL RNase A (Qiagen) using 4 cycles of 15 s sonification at 30% duty cycle and 30% output control ...