Labshake search
Citations for Qiagen :
401 - 450 of 458 citations for Annexin V Solution APC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... animals were maintained at 20 °C and washed down from NGM plates using M9 solution and subjected to RNA extraction using TissueDisruptor and the RNeasy Mini Kit from Qiagen. RNA preparations were used for qRT-PCR or RNAseq ...
-
bioRxiv - Developmental Biology 2022Quote: ... the animals were washed down from NGM plates using M9 solution and subjected to RNA extraction using the RNeasy Mini Kit from Qiagen. 1 μg total RNA from each sample was used for sequencing library construction ...
-
bioRxiv - Genetics 2022Quote: Minced tissues were homogenized with Sepasol RNAI solution (Nacalai Tesque, Kyoto, Japan) using a TissueLyser LT instrument (Qiagen, Hilden, Germany) set at 50 strokes/s for 5 min ...
-
bioRxiv - Genetics 2022Quote: ... were maintained at 20 °C and washed down from NGM plates using M9 solution and subjected to RNA extraction using the RNeasy Mini Kit from Qiagen. RNA-seq library preparation and data analysis were performed as previously described 46 ...
-
bioRxiv - Cell Biology 2024Quote: The RNA was extracted from the sorted HSCs using the Trizol-chloroform method followed by DNase treatment in the solution and cleaned up with an RNeasy MinElute clean-up kit from Qiagen. The purity of RNA was confirmed on the Bioanalyzer before proceeding with the sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumour samples were fresh-frozen in liquid nitrogen and stored at -80°C for protein isolation or preserved in RNAlater solution (Qiagen) for RNA isolation ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were directly lysed in the well using 350 µL of lysing solution (1% 2-mercaptoethanol in Buffer RLT; RNeasy Mini Kit, 74106, Qiagen) by pipetting over the well ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated from 10-μm FFPE samples from resected canine primary melanoma tumor or metastatic tumor lesions using an RNEasy FFPE Kit and deparaffinization solution (Qiagen). Isolated RNA was examined by Bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were sorted into 96-well plates containing lysis buffer with proteinase K solution in PKD buffer (1:16) (Qiagen) and were stored at -80ºC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and sperm using the Bio Basic EZ-10 Spin Column Genomic Minipreps kit for animal sample according to the manufacturer’s protocol except for sperm samples for which the kit ACL lysis solution was replaced by 300 μl of RTL lysis buffer (Qiagen) and 3 μl of mercaptoethanol ...
-
bioRxiv - Genetics 2023Quote: ... were homogenized in G2 solution from NucleoBond buffer kit by a stainless steel bead via the mechanical disruption of TissueLyzer (QIAGEN) for 10min (50 Hz) ...
-
bioRxiv - Biophysics 2023Quote: ... Cleaved PCNA was separated from His-SUMO and uncleaved His-SUMO-PCNA by incubating the protein solution with 5 ml Ni-NTA suspension (Qiagen) resuspended in solution D on a tilting table for 30 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The organs were weighed and lysed in 1 mL Triton X-100 solution (0.1% in PBS) using a TissueLyser II (QIAGEN, Germany) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 40 PGs from WPP animals were dissected under ice-cold phosphate-buffered saline (PBS) and stored in RNAlater solution (Qiagen). Total RNA was extracted using Trizol reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... Crystals were grown at 30°C by the hanging drop vapor diffusion method using 2 μL sample drops and 300 μL crystallization solution in a sealed chamber (EasyXtal 15-Well Tool, Qiagen). Crystals were soaked for 1h (for the Na structure or with the dibromo Intronistat B derivative ...
-
bioRxiv - Molecular Biology 2023Quote: ... expanded and initially screened for correct integration using homology- arm spanning PCRs (Immolase DNA polymerase, Bioline, supplemented with Q solution, Qiagen). Genotypes of positive clones were confirmed by Sanger sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... we used 6 mL of 55 °C Cell Lysis Solution from The Gentra Puregene® Cell and Tissue Kit (Qiagen) with 0.1 mg/mL proteinase K and 1% β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides were incubated with a PCR mix containing (100 µM dNTP, 1X thermopol Taq reaction buffer, 1X of Q solution (Qiagen) and 1 µM of each primer) ...
-
bioRxiv - Genetics 2024Quote: ... The first PCR amplified from HTT to GFP (F: ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC, R: GTCCAGCTCGACCAGGATG) Taq PCR Core Kit with Q solution (Qiagen) with 5 µL of the genomic DNA with initial denaturation 95°C (5 min) ...
-
bioRxiv - Neuroscience 2024Quote: ... After combining the two aqueous layers 1 equal volume 70% EtOH was added and the solution was added to an RNAeasy column (QIAgen). The RNA was washed with RW1 buffer ...
-
bioRxiv - Systems Biology 2024Quote: ... for 5 minutes and immediately lysed in the β-Mercaptoethanol-containing lysis solution from the RNeasy minikit (Qiagen Cat # 74104). RNA was extracted following the Qiagen kit instruction manual and eluted in 10mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: The colon tissues of the mice were dissected according to their anatomic features and stored immediately in RNAlater solution (QIAGEN) in RNAse-free 1.7-ml tubes (Denville Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... DNase digestion was performed by adding 80 µL of DNase solution (10 µL RNase-free DNase I stock (Qiagen #79254) plus 70 µL Buffer RDD (Qiagen #79254) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The spheres were washed twice and stained with 1:500 PI solution (Bio-Sciences) supplemented with 250 μg/mL RNAse A (Qiagen) and Hoechst nuclear counterstain (2 μg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total DNAs were extracted from the aqueous phase/ethanol solutions according to the manufacturer’s protocol using the DNAEasy Blood and Tissue Kit (Qiagen, Germantown, MD). Total DNA concentrations and purities were measured using NanoDrop (Thermo Fischer ...
-
bioRxiv - Genomics 2020Quote: ... pupae were immediately transferred from −80° C into a 50mL conical tube containing pre-prepared lysis solution consisting of 9.5mL Buffer G2 and 19μL RNase A (Qiagen Cat No. 19101). The pupae were then homogenized using a Dremel motorized homogenizer for approximately 30 seconds on the lowest speed ...
-
bioRxiv - Immunology 2020Quote: Initial crystallization hits were obtained via sparse matrix screening in 96-well plates using commercially available crystallographic solutions (Qiagen, Toronto, ON). Optimization of crystallization conditions was performed in 24-well plate format using the hanging drop vapor diffusion method ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissue lysis was performed by re-suspending ∼30mg of sliced frozen tissue in a solution containing 1% β-mercaptoethanol in RLT buffer (supplemented with antifoam agent; ID 19088, Qiagen). Next ...
-
bioRxiv - Neuroscience 2022Quote: ... 30µL of DNase and RDD buffer (1:7 ratio) containing solution from the RNase-Free DNase Set (Qiagen, Catalog No. 79254) was incubated on the columns at room temperature for 15 minutes before a second and third round of RNA was performed as well as a final spin to ensure the column was dry ...
-
bioRxiv - Microbiology 2023Quote: ... cells were collected by centrifugation and quickly washed with ice-cold water to remove the methanol and resuspended in RNAlater solution (Qiagen, 76104) for at least 2 hours ...
-
bioRxiv - Molecular Biology 2022Quote: Nunc MaxiSorp™ 96-well plates were coated with 75 ng/well of penta-His antibody in PBS solution (Qiagen, 34660) and incubated overnight at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Stigma tissues were removed from tube and DNA was extracted from the solution using DNeasy PowerSoil Pro Kit (Qiagen, Hilden Germany) following manufacturer’s instructions except the following modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA was extracted after disrupting the frozen leaves with metal beads in RLT and β mercaptoethanol solution using a Qiagen RNeasy plant mini kit (Qiagen) according to manufacturer’s instructions (without the optional DNase step) ...
-
bioRxiv - Microbiology 2024Quote: ... all samples were centrifuged at 5000rpm in a table-top centrifuge and the pellet was resuspended in CD1 solution of DNAeasy plant pro kit (Qiagen; 0142924730) along with 0.25-0.5 mm glass beads ...
-
bioRxiv - Pathology 2024Quote: DNA was extracted from the pooled skin lesion samples stored in the RNA preserving solution using the QIAsymphony® DSP Virus/Pathogen Kit (Qiagen). A species-specific PCR assay based on a previously published protocol [37] ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Media and Tryp-LE was aspirated and pelleted cells were lysed with 600μL of 1% b-mercaptoethanol (Thermo, Cat. #21985023) diluted in Buffer RLT solution (Qiagen, Cat. #79216), according to manufacturer recommendations ...
-
bioRxiv - Genomics 2024Quote: ... a buffy coat from a fresh 5-ml blood sample tube was aliquoted for peripheral blood mononuclear cells (PBMCs) isolation using RBC Lysis Solution (QIAGEN, 158904). The purified PBMCs were counted ...
-
bioRxiv - Developmental Biology 2021Quote: ... Every other hour ~300 embryos were counted and lysed in 350μl of a solution of RLT buffer and β-mercaptoethanol from the Qiagen RNeasy Micro Kit (Qiagen, Hilden, Germany). The lysates were immediately stored at −80°C until use ...
-
bioRxiv - Bioengineering 2021Quote: ... the mEV solution was incubated with 100 µl of precipitation buffer B from the Qiagen miRCURY Exosome Isolation Kit (Qiagen, Germantown, MD) overnight (∼12 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... and areas containing >30% tumor cells as determined by an expert pathologist were macrodissected and deparaffinated using Deparaffinization Solution (Qiagen, Hilden, Germany). DNA was extracted and purified with GeneRead DNA FFPE Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... For the detection of phosphorylated Serine residues a TBS solution with a 1:100 dilution of the Anti-Phospho-Serin Antibody (Qiagen, Hilden, Germany) was used ...
-
bioRxiv - Microbiology 2020Quote: ... an aliquot of the extracted RNA solution was added to the reaction mixture for the QuantiTect probe RT-PCR kit (Qiagen, Hilden, Germany), which contained 2x QuantiTect probe RT-PCR master mix ...
-
bioRxiv - Microbiology 2022Quote: Nineteen colonies isolated were resuspended in sterile PBS solution and the DNA was extracted using the DNeasy Powerlyzer Microbial Kit protocol (Qiagen, Hilden, Germany). After DNA extraction ...
-
bioRxiv - Microbiology 2022Quote: ... 2 g of soil was immediately transferred into pre-weighed sterile tubes containing 3 ml of LifeGuard soil preservation solution (Qiagen, Toronto, CA) to stabilize the RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted from primary solution with the removal of genomic DNA by the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). The purity and concentration of extrasted totel RNA were confirmed using a NanoDrop ONE spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA removal was performed by applying 80 μl of DNase I working solution (10 μL DNase stock + 70 μL 1x RDD buffer; RNase-Free DNase Set, Qiagen, Hilden, Germany) to the column and incubated for 15 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... from which total RNA was extracted by following an established protocol using the RNeasy mini-kit and an RNase-free DNase I solution (Qiagen, Germantown, MD) for in-column gDNA removal (24) ...
-
bioRxiv - Microbiology 2024Quote: ... 200 µl aliquots of the sample solution were processed by either the in-house method or using the DNeasy Blood & Tissue Kit (Qiagen Cat 69504) per manufacturers’ instructions.
-
bioRxiv - Evolutionary Biology 2021Quote: Genomic DNA was extracted from tissue and blood in salt solution using a DNeasy Blood and Tissue kit (QIAGEN Pty Ltd, VIC, Australia) or a Gentra Puregene Blood Kit (QIAGEN Pty Ltd ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). The tube was initially vortexed to homogenize the solution before incubation at 65 °C for 30 minutes with a short vortex every 5 minutes.