Labshake search
Citations for Qiagen :
401 - 450 of 1365 citations for 7 METHOXY 1H QUINOLIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... These primers were used to amplify the mRNA from the sample using Quantifast SyBR Green one –step RT-PCR kit (Qiagen, Netherlands) and the reactions were run using ABI 7500 real-time PCR instrument (Thermo Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification of a single product of the expected size by a primer pair was first confirmed by RT-PCR using Qiagen® One-Step RT-PCR kit (Qiagen) followed by agarose gel analysis of the amplified products ...
-
bioRxiv - Cell Biology 2020Quote: Cells were seeded in 6-well plates at a density of 80,000 cells/well one day prior to transfection and transfected with DR5-AS LNA GapmeR (Qiagen, United States) at a concentration of 40 nM or with 1500 ng of pcDNA3.1-DR5-AS with the Fugene HD transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the sample was divided into 5 parts and each part was purified using one PCR purification columns (PCR purification kit, Qiagen 28106). 50ul elution buffer was used the elute each column ...
-
bioRxiv - Cell Biology 2022Quote: ... and organoids at the end of passage one subjected to two weeks of differentiation (n=3) using the RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: The frozen filters were retrieved and cut into two halves using sterile surgical blades and DNA was extracted from one-half using DNeasy PowerSoil Kit (Qiagen, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each of the three reaction pellets were allowed to resuspend in TE for 1 hour at room temperature then pooled into one tube and purified across three Qiaquick PCR purification columns (Qiagen, 28104), eluted in the provided Elution Buffer and combined ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was quantified and qualitatively assessed using a nanodrop instrument following which one step qRT-PCR was performed using QuantiFast SYBR Green PCR kit (204054; Qiagen, Germany). Table 1 lists the primers used for mRNA quantification and cellular glyceraldehyde-3-phosphate dehydrogenase expression was used as a normalizing control ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatant was divided into two parts: one part was directly combined with nickel-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen, China); the other part was heated in a 65 °C water bath for 60 minutes and then centrifuged at 14000 rpm for 60 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... while URA3 and ACT1 levels were measured by one-step RT-PCR with specific primers (Supplementary Table S3) following the standard protocol of the RNeasy® Mini kit (Qiagen). All strains were propagated for at least 100 generations before analysis.
-
bioRxiv - Physiology 2020Quote: ... One μg of total RNA was reverse transcribed into cDNA using the Qiagen QuantiTect Reverse Transcription Kit (Qiagen, Valencia, California, USA) following manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 ng of each PCR product was pooled into one tube for purification using the QIAquick PCR purification kit (Qiagen #28106) and eluted into 30 µL Nuclease Free Water ...
-
bioRxiv - Genomics 2020Quote: ... high-molecular weight DNA was extracted from the entire body of one F1 pupa using a QIAGEN Blood & Culture DNA Midi Kit (Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was recovered from one-month-old of the DL1YTT001 culture by using a RNeasy® PowerSoil® kit (Qiagen). The kits mentioned above were used according to manufacturer protocols.
-
bioRxiv - Physiology 2023Quote: ... A one-step real-time quantitative polymerase chain reaction (RT-qPCR) was performed using a QuantiFast SYBR Green RT-PCR one-step kit on a Rotorgene 3000Q thermocycler (Qiagen, UK). Each reaction was setup as follows ...
-
bioRxiv - Microbiology 2023Quote: Total DNA was isolated from the whale blow and technical control samples in one batch using a QIAamp DNA Mini Kit (QIAGEN, Germany). The primers used for sequencing the 16SrRNA V3 and V4 regions were 341F (5’-CCTACGGGNGGCWGCAG ...
-
bioRxiv - Genetics 2023Quote: ... Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN ...
-
bioRxiv - Developmental Biology 2023Quote: DNA from two separate stage 42 embryos of F0 Cab and F0 Kaga and one stage 42 embryo of F1 hybrid Kaga/Cab was extracted using DNeasy Blood and Tissue Kit (Qiagen #69504) following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were seeded at 3 × 105 cells.well−1 in 6-well plates and transfected 24 h later with one pmiRGLO derivative construct per well (0.9 µg plasmid) using Effectene (Qiagen cat. #301425). After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat ...
-
bioRxiv - Neuroscience 2023Quote: ... One well of a 60-80% confluent 12-well was harvested with 700 μl QIAzxol Lysis Reagent (Qiagen; Cat. No. 79306) for subsequent RNA extraction with RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: We extracted DNA from one of the two duplicate swabs using a modified version of the DNeasy® Blood and Tissue kit (QIAGEN) optimized to recover DNA from swabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 katna1-/-MZ and one pool of 10 wild-type embryos (at 24 hpf) using the RNeasy Mini-kit (Qiagen, France) and reverse-transcribed using the Superscript RT II Kit with random hexamers (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... the ViiA 7™ Real-Time PCR system was used to run the Human Stem Cell RT² Profiler™ PCR Array (Qiagen, Hilden, Germany). For the analysis of cardiac differentiation-associated genes ...
-
bioRxiv - Evolutionary Biology 2021Quote: Total retinal mRNA was extracted from one of each study animal’s retinas with an RNeasy Mini Kit and QIAshredder (Qiagen, Valencia, CA, USA), quantified with a NanoVue spectrophotometer (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... We collected 20 CA1 dissectates in one isolation cap (Molecular Machines and Industries GmbH, Eching, Germany) before adding RLT lysis buffer (AllPrep Kit, Qiagen, Hilden, Germany). Samples from one individual were collected the same day ...
-
bioRxiv - Biophysics 2021Quote: ... with a double digoxigenin-labeled primer (Biomers GmbH) on one side and a phosphoprimer on the other side and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany). The phosphorylated strand is digested by Lambda exonuclease (New England Biolabs ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from seedlings in the one to three leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, Germantown, MD). DNA libraries were prepared following the protocol of DNA digestion with PstI and MspI restriction enzymes (Poland et al ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was extracted from a cell pellet with approximately one million ECs or VSMCs at the third passage using an RNeasy Mini Kit (Qiagen, Venlo, Netherlands). The remaining genomic DNA traces were removed with an on-column DNase digestion (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from individual seedlings at the one-to three-leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, MD, USA). Genotyping by sequencing was conducted using Illumina HiSeq® 2500 and NovaSeq 6000 ...
-
bioRxiv - Zoology 2021Quote: ... High-molecular-weight genomic DNA was prepared from the kidney of one male shrew using a Genomic-tip 20/G (QIAGEN, Germantown, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Correct introduction of the NS1 mutations was verified via cDNA synthesis of viral RNA using the One-Step RT-PCR kit (Qiagen, Hilden, Germany), amplification and sequencing using NS-specific primers ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2020Quote: We extracted DNA from 21 modern cheetah and one Puma concolor tissue sample using the Quiagen DNeasy Blood and Tissue kit (Qiagen, Venlo, Netherlands) and 32 diluted blood samples using the innuPREP Blood Kit (Analytik Jena AG ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from pooled ipsilateral lumbar (L4-6) DRGs from one rat using the Qiagen RNeasy Mini Prep Kit (Qiagen, Valencia, CA) with on-column DNase digestion (Qiagen ...
-
bioRxiv - Physiology 2021Quote: ... reaction tubes were transferred to a Rotor-Gene Q PCR thermal cycler for product amplification using a one-step protocol (QuantiFast SYBR® Green RT-PCR Kit, Qiagen, UK). The amplification protocol was as follows ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from seedlings at the one to three leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, Germantown, MD). DNA libraries were prepared following the protocol of DNA digestion with PstI and MspI restriction enzymes (Poland et al ...
-
bioRxiv - Genomics 2020Quote: ... we extracted genomic DNA from leaf segments cut from areas with one pustule or very few pustules using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). We then amplified the ITS2 region using the primer pair RUST2inv (5′-GATGAAGAACACAGTGAAA ...