Labshake search
Citations for Qiagen :
201 - 250 of 1422 citations for 7 METHOXY 1H QUINOLIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: RT-PCR was performed on the extracted RNA with One-Step RT-PCR kit (Qiagen, #210212) according to the manufacturer’s instructions and the following conditions ...
-
bioRxiv - Genomics 2023Quote: ... which were merged into one assembly using CLC-Bio Genomics Workbench De Novo Assembly (Qiagen, v11.0.1) with default parameters ...
-
bioRxiv - Genomics 2023Quote: ... and the BioSprint 96 one-for-all Vet Kit utilizing ASL buffer (19082; Qiagen, Germantown, MD) and bead beating ...
-
bioRxiv - Cancer Biology 2023Quote: ... genomic libraries were constructed from adductor muscle DNA from one individual cockle (DNeasy Tissue Kit, Qiagen), from Deep Bay ...
-
bioRxiv - Cancer Biology 2024Quote: ... One µg of RNA was used to generate cDNA with QuantiTect Reverse Transcription kit (Qiagen #205313). For the RT-PCR reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary neurons were harvested one week later on DIV19 after which RNA was extracted (RNeasy, QIAGEN) and submitted to the Genomics core lab at the Heflin Center for Genomic Sciences at the University of Alabama at Birmingham for library preparation ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from the gut samples (7-10 guts/sample) using the RNeasy Mini kit (Qiagen) and the on-column DNase I treatment (79254 ...
-
bioRxiv - Biochemistry 2021Quote: ... supernatant was harvested after 7 days of expression and incubated with 300 μL of Ni-NTA resin (Qiagen) at 4°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted from seedlings 7 dpg using the RNeasy Plant RNA Extraction kit (Qiagen Ltd., Surrey, UK). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: Tissue samples at day 0 and 7 were collected from devices and dissociated in the lysis buffer (Qiagen) by agitating with an electronic pestle for 1 min ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from MCF-7 cells (1×106 cells/well) was isolated using RNeasy Mini kit (74106; Qiagen), and 500ng cDNA was synthesized with random hexamers by reverse transcription (SuperScript III ...
-
bioRxiv - Pathology 2020Quote: ... diffracting crystals of P1_102-157 were obtained at 4°C from condition 7 of the Classic kit (Qiagen) containing 0.1 M tri-Sodium citrate pH 5,6 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 120 µL of elution buffer of elution buffer II (10 mM Tris pH 8.0, 1 mM EDTA, 0.67% SDS) and 7 µL Proteinase K (Qiagen) was added ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Transfection into C2C12 or MCF-7 cells utilized a lipid-based reagent (Fast-forward protocol, Effectene reagent, Qiagen). As a reference for transfection efficiency ...
-
bioRxiv - Plant Biology 2023Quote: ... The grinding was done using 7 mm stainless steel beads with TissueLyser II bead mill (Qiagen, Hilden, Germany), 2 minutes totally at 25 Hz ...
-
bioRxiv - Immunology 2023Quote: ... cytometry-sorted 7-AAD- CD45+CD11b+F4/80+ cells were lysed in 350µL RLT lysis buffer (Qiagen, 79216). At 4 days post injury ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA from h-iECs which have been expanded for 7 days was extracted using Rneasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and their bat orthologues [(Pteropus alecto (XP_006907484.1) and Desmodus rotundus (XP_024413747.1)] were subjected to multiple alignment using CLC workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark).
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from ME49 Δhxgprt::Fluc tachyzoites and bradyzoites induced for 7 days at pH 8.2 using RNeasy Mini Kit (Qiagen) combined with QIAshredder (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... A neighbour-joining tree was built using the Jukes-Cantor nucleotide distance model and 1,000 bootstraps in CLC Sequence Viewer 7 (Qiagen).
-
bioRxiv - Microbiology 2020Quote: DNA for metagenomic sequencing was extracted from ~7 g sediment (~0.7 g sediment in 10 individual lysis tubes) using PowerSoil DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the samples were run in the ViiA 7 Real-Time PCR System with the QuantiTect SYBR Green (Qiagen, 204143) (2017) ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was harvested from post-transfection HuH-7 cells using the DNeasy Blood & Tissue Kit (Qiagen, catalog #69506). Similarly ...
-
bioRxiv - Immunology 2023Quote: M1 and M2 macrophages (300,000/well, 96-well plate) were transfected on Day 7 with MALAT1 or control GapmeRs (Qiagen). MALAT1- or control GapmeR-transfected M1 and M2 Mφ were incubated with Texas Red-conjugated Ova and DQ-conjugated Ova (both 1 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: Undifferentiated myoblasts (day 0) and differentiated myotubes (day 7) were collected and lysed in 1 mL of Qiazol (Qiagen). RNA from undifferentiated and differentiated myoblasts was extracted using the Qiagen miRNeasy kit (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... GC B cells (Live/Dead-CD19+IgD-CD95+GL-7+) and naïve B cells (Live/Dead-CD19+IgD+) were flow sorted into RLT Plus buffer (Qiagen) following pre-enrichment with the Pan B Cell Isolation Kit II (Miltenyi) ...
-
bioRxiv - Plant Biology 2019Quote: ... corm (two independent replicates) and rootlets (one replicate) was extracted with the RNeasy plant mini kit (Qiagen). On-column DNase I treatment was performed with RNase-free DNase I (Qiagen) ...
-
bioRxiv - Physiology 2020Quote: ... mixed with one volume of 70% ethanol and applied directly to an RNeasy Mini Kit column (Qiagen). DNAse treatment on the column and total RNA recovery were performed as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: One µg of DNA was bisulfite-treated using the EpiTect® 96 Bisulfite Kit (Qiagen, Hilden, Germany) and analysed using the Infinium Human Methylation 450K BeadChips (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Viral genomic RNA (gRNA) was detected with a one-step real-time RT-PCR assay (Quantifast, Qiagen) using primers and probes generated to target either the SARS-CoV-2 E (28 ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-PCR was carried out using the QuantiTect probe RT-PCR kit (Qiagen, Valencia, CA) with 500 nM forward and reverse primers and 50 nM labeled probes (DENV2-FAM and ZIKV-FAM and PGK1-VIC TaqMan) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from one-week-old Arabidopsis seedlings using the RNeasy Plant Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... One third of specimens were extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA), while later extractions used a CTAB/PCI extraction approach (Chen et al. ...
-
bioRxiv - Genomics 2022Quote: ... bacterial pellets were pooled into one tube and DNA extracted with the Gentra Puregene tissue kit (Qiagen) with resuspension of the DNA pellet in 100 µl of nuclease-free water.
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of RNA was reverse transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen). The template amount of 6.6 ng RNA equivalent per wellt was used and the PCR reaction was performed in triplicate using the total volume of 8 µl in 384 well plate format ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA were extracted from approximately one million to two million cells using RNeasy Mini Kit (QIAGEN) according to the recommendation of manufacturer and then NEBNext® Poly (A ...
-
bioRxiv - Microbiology 2021Quote: ... RORC1 and RORC2 gene expression was evaluated by One step SYBR green real-rime RT-PCR (Qiagen) using a Light-Cycler 480 II as follows ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA was extracted from one or two leaves of each individual using the DNeasy Plant kit (QIAgen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (QIAGEN, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... One section was added to a MACs M tube (Miltenyi Biotech, U.K.) containing 1ml Qiazol (Qiagen, U.K.) and dissociated on a GentleMACs (Miltenyi Biotech ...
-
bioRxiv - Immunology 2020Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR Kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT Mix ...
-
bioRxiv - Immunology 2020Quote: ... Extraction of these samples was performed using the BioSprint™96 One-For-All vet kit (Qiagen) and Kingfisher Flex platform as per manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... or 500 ng of total RNA for reverse transcription using the One Step RT PCR-Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT mix ...
-
bioRxiv - Zoology 2023Quote: Genomic DNA was extracted from one specimen using the Dneasy Blood & Tissue kit (Qiagen, Valencia, CA, USA), following the manufacturer’s instructions but with the initial proteinase K lysis step extended to 16 hours at 56°C with continuous agitation.
-
bioRxiv - Neuroscience 2023Quote: ... VG and DRG were transferred into an 1.5ml tube containing one Tungsten Carbide bead (3mm, Qiagen, #69997) and 1 mL of Qiazol lysis reagent (Qiagen ...