Labshake search
Citations for Qiagen :
401 - 450 of 4272 citations for 6 METHYL 4 4 NITRO PHENYL 2 OXO 1 2 3 4 TETRAHYDRO PYRIMIDINE 5 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... 50 µL of saturated bacterial cultures were extracted using a DNeasy UltraClean 96 Microbial Kit (Qiagen, 10196-4).
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... PCR products were individually cleaned up and quantified using the UltraClean 96 PCR Cleanup Kit (Qiagen 12596-4) and the Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120 ...
-
bioRxiv - Pathology 2020Quote: ... diffracting crystals of P1_102-157 were obtained at 4°C from condition 7 of the Classic kit (Qiagen) containing 0.1 M tri-Sodium citrate pH 5,6 ...
-
bioRxiv - Cell Biology 2019Quote: ... knockdown of KCNB1 expression in human cells was carried out using a mixture of 4 siRNA duplexes (Qiagen; Cat# ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 0.6 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture (1 ml beads per 1 l expression culture was used in case of Drosophila BiP ...
-
bioRxiv - Biophysics 2019Quote: ... The SpyTag-(Cpa)4-SpyTag and the HaloTag-SpyCatcher constructs were cloned into the expression plasmid pQE80L (Qiagen). Protein expression and purification was done as described elsewhere36 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1.28 M sucrose, 40 mM Tris-Cl, pH 7.5, 20 mM MgCl2, and 4% Triton X-100; QIAGEN) and then digested by digestion buffer (QIAGEN buffer G2 ...
-
bioRxiv - Microbiology 2022Quote: ... 14 μL of filtered supernatant was combined with 4 μL of RDD buffer (Qiagen, RNase-Free DNase Set) and 2 μL of DNase I and dissolved as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were lysed (1.28 M sucrose, 40 mM Tris-HCl [pH 7.5], 20 mM MgCl2, and 4% Triton X-100; Qiagen) and digested (800 mM guanidine–HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 minutes 4°C and the supernatant was incubated with pre-equilibrated Ni-NTA agarose beads (Qiagen, #1018244) with shaking on ice for 3 hours ...
-
bioRxiv - Molecular Biology 2023Quote: We also used the RT2 Profiler PCR array mouse fibrosis (cat. #PAMM 120-ZE-4) kit from Qiagen to detect the expression of 84 fibrosis-related genes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 sections 10 µm thick were placed in a chilled Eppendorf tube and RNA extraction protocol from Qiagen was performed (Rneasy FFPE Kit 73504 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated from cSCC cell lines (n = 8) and NHEKs (n = 4) using miRNeasy Mini Kit (Qiagen), and the RNA-seq analysis was performed using Illumina HiSeq2500 system using paired-end sequencing chemistry with 100bp read length (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed twice with the blocking buffer and incubated at 4 °C with primary antibodies (mouse anti-Strep, Qiagen, Cat #: 34850, 1: 150 dilution) (rabbit anti-PDI ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cancer Biology 2019Quote: ... Germany) using a metal ball for 2×2 min at 25 s−1 in 600 μl of RLT buffer (Qiagen, Germany) with 1% β-mercaptoethanol ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2022Quote: RNA was isolated from ∼100,000 MSNs from 4 independent differentiations per experimental group according to the manufacturer’s protocol and purified using RNeasy columns (Qiagen). A total of 72 mRNA libraries for Illumina sequencing were prepared using KAPA mRNA HyperPrep Kit (KAPA Biosystems ...
-
bioRxiv - Genetics 2019Quote: ... cells (from 4 × 104 to 2.3 × 106) were pelleted at 400xg for 4 min and resuspended in 700 μL RLT buffer (Qiagen) with beta-mercaptoethanol (1:100) ...
-
bioRxiv - Biochemistry 2020Quote: ... Lysates were centrifuged at 30,597xg and 4°C for 20min and the supernatant was bound to Ni-NTA Agarose resin (Qiagen), washed with 10 CV of wash buffer (50 mM HEPES-KOH pH=7.5 ...
-
bioRxiv - Genetics 2019Quote: Single cells meant for RNA processing were sorted into 96-well full-skirted Eppendorf plates that were pre-chilled at 4°C and were prefilled with 10μL of lysis buffer consisting of TCL buffer (Qiagen) supplemented with 1% beta-mercaptoethanol ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was cleared using a JA-20 rotor (18,000 rpm for 30 min at 4°C) and incubated with Ni-NTA superflow resin (Qiagen) for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: Tissue lysates were further homogenized and centrifuged at 10,000 g for 10 min at 4°C in microcentrifuge spin columns (QIAshredder, Qiagen) to obtain clear protein lysate ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from P15 liver tissue (n=4 biological replicates per strain) using QIAzol Lysis Reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... 19 motifs and 4 differential motifs were analyzed to predict upstream regulators using Ingenuity Pathway Analysis (IPA, QIAGEN Inc.). Gene expression signatures indicative of HMO and motif abundance were defined as genes differentially expressed with abundance in the previous limma analysis(FDR q<0.05 and |Fold Change|>1.5).
-
bioRxiv - Plant Biology 2020Quote: ... 10mM imidazole was added and incubated on rotator for overnight at 4°C in the presence of 2.5ml of Ni-NTA beads (Qiagen). The beads were washed with EB containing 6M guanidine-HCl and 0.25% Triton X-100 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and clarified lysate was purified on Ni-NTA resin (QIAGEN) eluting in buffer A supplemented with 200 mM imidazole in gravity flow ...
-
bioRxiv - Molecular Biology 2022Quote: His-Prs or its variants (10 µg) were bound to 4 µl of Ni-NTA Magnetic Agarose Beads (Qiagen) in 50 µl interaction buffer (50 mM Tris pH 9.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and clarified lysate was purified on Ni-NTA resin (QIAGEN) eluting with buffer A supplemented with 250 mM imidazole in gravity flow ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.5 mM GDPNP-Mg2+) were obtained at 4°C using 0.2 M Lithium nitrate and 20% PEG3350 (PEG Suite I, Qiagen) as precipitating agent ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and clarified lysate was subjected to Ni-NTA resin (QIAGEN), washed and protein eluted with buffer B supplemented with 250 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... cleared by centrifugation (20 min, 20,000 × g, 4°C) and the clarified lysate was purified on Ni-NTA resin (QIAGEN) eluting in buffer C supplemented with 200 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and clarified lysate was purified on Ni-NTA agarose resin (QIAGEN) eluted with buffer A supplemented with 0.5 mM TCEP and 200 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and cleared lysate was subjected to Ni-NTA resin (QIAGEN), washed and protein eluted with buffer B (20 mM Tris-HCl pH 8.0 ...
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... Two hundred fifty microliters of each sample were transferred into 96-well PowerBead Plates (Qiagen, 27500-4-EP-BP). Seven hundred fifty microliters of RLT buffer from an AllPrep DNA/RNA 96 Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 ng/μL RNA carrier as described by the supplier of the RNeasy® Micro kit (Qiagen, Hilden, Germany).
-
bioRxiv - Genomics 2022Quote: ... samples were incubated an additional 30 minutes with 20 µL Proteinase K and 4 µL RNase A (Qiagen 19101) and subsequently eluted for DNA using DNeasy Blood and Tissue kit ...
-
bioRxiv - Cancer Biology 2019Quote: ... and was run on miScript miRNA PCR Array Human Ovarian Cancer plates (Qiagen, MIHS-110ZE-4, 384 well plate). PCR plates were read the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Biophysics 2020Quote: ... Debris was removed by centrifugation (20,000×g, 30 min, 4°C) and the supernatant was incubated with Ni-NTA resin (Qiagen) for 30 min at 4°C ...