Labshake search
Citations for Qiagen :
451 - 500 of 4272 citations for 6 METHYL 4 4 NITRO PHENYL 2 OXO 1 2 3 4 TETRAHYDRO PYRIMIDINE 5 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted from ~200 mg stool using the QIAGEN DNeasy PowerSoil HTP 96 Kit (Qiagen, Cat #12955-4) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Total RNA was harvested at 4 and 24 hours in biological triplicates using the RNeasy plant mini kit (Qiagen). Purified RNA was verified for intactness on a Bioanalyzer 2100 (Agilent ...
-
bioRxiv - Genomics 2019Quote: ... while the manual plate samples were processed using the Qiagen DNeasy PowerSoil HTP 96 kit (Qiagen, Cat# 12955-4).
-
bioRxiv - Microbiology 2019Quote: ... 700 μL of cold methanol and 140 μL of EDTA 0.1M were added and vigorously mixed (4 x 45 s) in a mini-bead-beater-8 (Biospec Products, Qiagen). By this way ...
-
bioRxiv - Molecular Biology 2021Quote: ... The solution was further cleared at 20,000 × g at 4 °C and the supernatant was incubated with Ni-NTA resin (Qiagen) for 2 h at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Frozen samples were homogenized with zirconia beads YTZ-4 (AS-ONE, Osaka, Japan) using TissueLyser II (Qiagen, Hilden, Germany), and total RNA was then extracted using the Maxwell 16 LEV Plant RNA Kit (Promega ...
-
bioRxiv - Immunology 2020Quote: ... DNA was extracted using the Qiagen MagAttract Power Microbiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) and used for rRNA sequencing and Helicobacter spp ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from multiples of 4 million resting CD4+ T cells according to the manufacturer’s instructions (QIAamp DNA Mini and Blood Mini Kit, QIAGEN). Amplification of NFL genomes was performed by limiting dilution ...
-
bioRxiv - Microbiology 2022Quote: ... The aqueous phase was separated by centrifugation at 13,000 g at 4°C and RNA was purified using the RNeasy Mini Kit (Qiagen) with on-column DNAse digestion ...
-
bioRxiv - Immunology 2022Quote: ... Lysate was cleared from debris by centrifugation at 30,000 g and 4°C for 30 min before being loaded onto a Ni-NTA Superflow cartridge (Qiagen) using an Äkta Explorer chromatography system (GE Healthcare) ...
-
bioRxiv - Pathology 2023Quote: ... Genomic DNA was extracted from these colonies and from the organs with DNeasy UltraClearn microbial kit (QIAGEN, 10196-4). After performing qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... or from perfused organs homogenized (Fisher Bead Mill 4, 2.4 mm metal beads) prior to extraction (DNA Maxi Kit; Qiagen). For STEVOR assay ...
-
bioRxiv - Biochemistry 2023Quote: ... The lysate was cleared by centrifugation at 10,000g for 30 min at 4 °C and applied to 15-mL equilibrated Ni-NTA beads (Qiagen). The Ni-NTA column was washed with 150 mL of buffer B (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... The lysate was cleared by centrifugation at 10,000g for 30 min at 4 °C and applied to 15-mL equilibrated Ni-NTA beads (Qiagen). The Ni-NTA column was washed with 150 mL of buffer B (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Genomics 2023Quote: ... samples were incubated an additional 30 minutes with 20 uL Proteinase K and 4 uL RNase A (Qiagen 19101) and subsequently eluted for DNA using DNeasy Blood and Tissue kit.
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (3,000 g, 15 min, 4°C) and total RNA was isolated using the miRNeasy Mini Kit (QIAGEN) in combination with the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Microbiology 2023Quote: ... Cell lysate was cleared by centrifugation at 100,000 × g for 30 min at 4 ⁰C and then incubated with Ni2+-NTA agarose beads (Qiagen) for 30 min at 4⁰C ...
-
bioRxiv - Systems Biology 2023Quote: ... and spleen) (4 samples per treatment and time combination) was isolated with the QIAGEN miRNeasy mini extraction kit (QIAGEN) and cDNA was synthesized with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pellets of 300 µL culture using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or from whole fecal pellets using a DNeasy PowerSoil HTP 96 kit (Qiagen 12955-4) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from stool swabs stored in RNAlater using the DNeasy PowerSoil HTP 96 Kit (Qiagen 12955-4). To avoid cross-contamination that could lead to erroneous inferences of strain sharing81 ...
-
bioRxiv - Microbiology 2023Quote: ... The soluble lysates obtained after two rounds of centrifugation at 18,000g and 4°C were incubated with glutathione agarose beads (Pierce) or Ni2+-NTA beads (QIAGEN). Recombinant proteins were eluted from the beads using 10 mM reduced glutathione in a Tris (50 mM Tris-HCl ...
-
bioRxiv - Genomics 2024Quote: ... after the lysis step (step 4 in handbook protocol) and (ii) adding 700 mL of buffer RWT (Qiagen 1067933) instead of the provided RW1 (step 6 in handbook protocol).
-
bioRxiv - Microbiology 2024Quote: ... Flag-SHOC2 was cleaved from 6X-His-MBP by incubating 37 mg purified protein with 0.65 mg TEV protease at 4°C overnight followed by affinity purification using Nickel affinity resin (Qiagen) where cleaved Flag-SHOC2 was collected in the flow-through.
-
bioRxiv - Microbiology 2024Quote: ... Lysates were clarified by centrifugation at 21,000× g at 4°C and loaded onto gravity flow Ni-NTA agarose columns (Qiagen), followed by washing with 50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 h time points were immediately mixed with 2 x volume of RNAProtect® (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs used were RAPH1 siRNA #2 (Hs_RAPH1_2, SI00698642) and RAPH1 siRNA #5 (Hs_RAPH1_5, SI04300982) provided by Qiagen.
-
bioRxiv - Cancer Biology 2023Quote: Each qPCR reaction consisted of 5 μL of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 0.5 μL of 10 μM forward and reverse primers each ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 nucleic acids were isolated from 300 µl viral transport media using the QIAamp Viral RNA Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... the supernatant was added to 2 ml of pre-equilibrated Nickel-nitrilotriacetic acid (Ni-NTA) agarose (QIAGEN, Cat. No. 30210) 50% slurry and rotated at 4°C for 2 h ...
-
bioRxiv - Plant Biology 2019Quote: ... Supernatant was applied twice to a column containing a gel bed of 2 ml nickel-nitriloacetic acid agarose (Qiagen, www.quiagen.com) equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... The soluble extracts were applied to 2-ml columns of nickel-nitrilotriacetic acid- agarose (Ni-NTA) (QIAGEN catalog no. 30210) that had been equilibrated with lysis buffer without protease inhibitors ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested by centrifugation at 4°C followed by cell lysis/RNA extraction using RNEasy plus mini kit (Qiagen) according to manufacturer’s instructions ...