Labshake search
Citations for Qiagen :
401 - 450 of 2150 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... nucleic acid extraction was performed using 280 μL of each sample in duplicate by Qiagen viral RNA extraction protocol and quantified RNA was further processed for template preparation using the Ion Chef System ...
-
bioRxiv - Genomics 2020Quote: ... cfDNA was extracted from plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Valencia, California) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... CRY2 protein was isolated by Ni2+-nitrilotriacetic acid (Ni-NTA) affinity chromatography (Qiagen, Hilden, Germany) following elution with 50 mM Tris buffer pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal DNA was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Cancer Biology 2020Quote: Cell-free DNA (cfDNA) was isolated using QIAamp Circulating Nucleic Acid Kit (Qiagen®, Germany) from different volumes of plasma samples (850µl to 2ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nucleic acids were extracted from leech samples using the DNeasy 96 Blood & Tissue kit (Qiagen) (see Axtner et al ...
-
bioRxiv - Microbiology 2022Quote: ... nucleic acid was extracted from the tissue sample using QIAamp DNA extraction kit (Qiagen, Germany) as per the recommended protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tumor nucleic acid extractions were performed using the Allprep DNA/RNA/miRNA Universal kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the QIAamp Circulating Nucleic Acid kit (kit Q; cat# 55114, Qiagen, Germantown, MD, USA).
-
bioRxiv - Microbiology 2020Quote: Total nucleic acid was extracted from respiratory specimens using a QIAamp DNA Mini Kit (QIAgen), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The soluble fraction was passed through 3ml of nickel nitrilotriacetic acid agarose (Ni-NTA) (Qiagen), washed with 20 mM imidazole ...
-
bioRxiv - Cell Biology 2021Quote: The locked nucleic acid-modified oligonucleotides with a fully phosphorothioate backbone were produced by Qiagen as described (Rossiello et al ...
-
bioRxiv - Developmental Biology 2020Quote: DNA was extracted from blood on an automated nucleic acid extraction platform called QiaSymphony (Qiagen) with a magnetic bead-based extraction kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... cfDNA was extracted from 4ml of plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN, 55114), it was quantified via Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Viral nucleic acids were then isolated using QIAamp MinElute Virus Spin Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions with some modifications described (Cosentino et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... A locked nucleic acid probe (mmu-miR-450b-5p miRCURY LNA miRNA Detection probe; Qiagen) was used to detect miR-450b while standard DNA oligonucleotide probes were used for other miRNAs ...
-
bioRxiv - Developmental Biology 2023Quote: DNA was extracted from blood on an automated nucleic acid extraction platform called QiaSymphony (Qiagen) with a magnetic bead-based extraction kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribonucleic acid (RNA) was extracted and purified using RNeasy RNA Isolation Kit (QIAGEN, Germantown, MD) then reverse transcribed into complementary deoxyribonucleic acid (cDNA ...
-
bioRxiv - Genomics 2024Quote: ... CfDNA was extracted from the plasma samples using the QIAamp Circulating Nucleic Acid Kit (Qiagen) and approximately 3 – 8 ng of cfDNA was isolated from each plasma sample for use in the 5hmC-Seal assay ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CSF3R protein was enriched by nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen 30210) and further purified by size-exclusion chromatography on a Superdex 75 10/300 GL column (Cytiva 17517401 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Genomic nucleic acid isolation was performed using the MagAttract HMW DNA Kit (Qiagen, Hilden Germany) precisely following the instructions of the fresh or frozen tissue protocol ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Recombinant Fab proteins were purified from the culture supernatant by nickel-nitrilotriacetic acid agarose (Qiagen). Recombinant mAbs were affinity purified by MabSelect resin (Cytiva ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and nucleic acid was extracted using EZ1 Advanced XL extraction with a Virus Card (QIAGEN). Six of the 20 FACS populations did not generate sufficient DNA and were not subsequently sequenced ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was purified by incubation with nickel-nitriloacetic acid (Ni-NTA) agarose resin (Qiagen) for 3h at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clarified supernatant was loaded onto pre-equilibrated nickel-nitrilotriacetic acid (Ni-NTA) (Qiagen, USA) affinity column and flow-through was collected after incubation for 30 min at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was extracted using the Qiagen RNA nucleic acid extraction kit (Qiagen, Hilden, Germany) at 0- ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2024Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... using stainless steel beads (5 mm; Qiagen). RNA was then extracted using a RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...