Labshake search
Citations for Qiagen :
651 - 700 of 2150 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: NALCN-siRNA and control-siRNA with modification of 3’-AlexaFluor488 (QIAGEN, Maryland, USA) were dissolved in RNase-free water (NALCN-siRNA ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from ~3×106 cells was extracted with DNeasy Blood&Tissue kit (Qiagen). For SUM159PT/MDA-MB-231 hybrids and MCFDCIS/SUM159PT from lung metastasis CytoSNP-12 v2.1 BeadChip array from Illumina was used and data analyzed with GenomeStudio 2.0 software (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... and 12-days post infection (3 samples/group) using the RNeasy Kit (Qiagen). Samples were processed at the Baylor College of Medicine Genomic and RNA Expression Profiling Core (Houston ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with pNL4-3 vectors using Attractene Transfection Reagent (QIAGEN, Germany). After 8 hr ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatant was collected on day 3 post transfection and Ni-NTA agarose (Qiagen) was used to purify the protein ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Molecular Biology 2023Quote: ... and total RNA was extracted from 3 week-old plants by RNeasy (QIAGEN) or Direct-zol (ZYMO RESEARCH) ...
-
bioRxiv - Microbiology 2023Quote: ... Digested protein was mixed with 3 ml of NTA super-flow resin (Qiagen) that had been pre-equilibrated in wash buffer ...
-
bioRxiv - Microbiology 2022Quote: ... in microcentrifuge tubes with 3 mm Tungsten Carbide Beads (Qiagen, St. Louis, MO). Supernatants were clarified by centrifugation and frozen at -80ºC until viral titration ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Genetics 2024Quote: ... Insects were homogenized for 3 min at 30 Hz with TissueLyser II (Qiagen), using three 3 mm steel beads (TIS GmbH ...
-
bioRxiv - Microbiology 2024Quote: ... 3 times for 30 s at 30 Hz using Tissue Lyser II (Qiagen). After centrifugation at 2,000 rpm for 5 min ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Neuroscience 2022Quote: ... n = 3) from patient and control tissues using the RNeasy mini kit (Qiagen) and diluted to a concentration of 10ng/µL ...
-
bioRxiv - Biophysics 2023Quote: The library preparation was done using the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). A total of 10ng purified RNA was converted into cDNA NGS libraries ...
-
bioRxiv - Genetics 2022Quote: ... 10 μg dsRNA were transfected into 3×106 Drosophila cells using Effectene (QIAGEN).
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from Calu-3 cells with RNeasy mini kit (Qiagen). Extracted RNA was quantified and purity was verified by Nanodrop 2000 spectrophotometer (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleared and filtered supernatants were applied to 3 mL Ni-NTA Agarose (QIAGEN) equilibrated in buffer B (20 mM HEPES/KOH pH 7.8 ...
-
bioRxiv - Genomics 2024Quote: ... Results were analysed with the PyroMark Q24 software (version 2.0.8, build 3, Qiagen). DNA methylation values obtained via pyrosequencing were compared between the HS and Control groups using a Wilcoxon test.
-
bioRxiv - Immunology 2024Quote: ... Frozen cells were lysed directly in 3 volumes of QIAzol lysis reagent (QIAGEN). Genomic DNA removal and RNA extraction was performed using the Direct-zol RNA Microprep Kit (Zymo) ...
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of Buffer D2 (REPLI-g Single Cell Kit, Qiagen) and 1 μL of 500 μM exonuclease-resistant random primer were then added to the lysed cells to denature the DNA prior to vortexing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated on 4-12% Bis-Tris gels (Novex, Qiagen) using MOPS running buffer (Novex ...
-
bioRxiv - Cell Biology 2022Quote: ... and TBT (4 biological replicates per condition) with RNeasy columns (Qiagen), followed by oligo-dT selection ...
-
bioRxiv - Molecular Biology 2024Quote: ... the MagAttract PowerMicrobiome DNA/RNA extraction kit (Qiagen 27500-4-EP) and for 16 samples ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 mg of freeze-dried and ground roots were mixed with 1.6 mL of 1 M perchloric acid and homogenized in a TissueLyser II (Qiagen) in microtubes containing 6 glass beads of 2.8 mm in diameter ...
-
bioRxiv - Microbiology 2020Quote: ... Extraction of viral nucleic acids from clinical sample was performed with a QIAamp Viral RNA Mini Kit (Qiagen #52906) as described by manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... Nucleic acid was first extracted from each blood sample using QIAamp MinElute Virus Spin kits (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Headless HA stalk proteins were expressed in 293F cells and purified using nickel-nitrilotriacetic acid agarose (no. 1018244, Qiagen) in 5-ml polypropylene columns (no ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acid sequence alignments and a phylogenetic tree of CEC3 homologs were generated using CLC Genomics Workbench8 (QIAGEN bioinformatics).
-
bioRxiv - Microbiology 2022Quote: ... followed by total nucleic acid extraction of 400 ul of pretreated stool using the EZ1 Virus Mini Kit v2.0 (Qiagen). Extracts were eluted in 60 ul volume.
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was collected and was mixed with a small volume of preequilibrated Ni-nitrilotriacetic acid (NTA) beads (Qiagen) for 2 h on a rocking platform at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Neuroscience 2020Quote: ... PrP was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). In the RT-QuIC assay ...
-
bioRxiv - Neuroscience 2020Quote: ... was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified from inclusion bodies by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). Recombinant hamster PrP (HaPrP ...
-
bioRxiv - Biochemistry 2021Quote: ... The ankyrin repeat domains were purified over a Ni-nitrilotriacetic acid column (2.5 ml column volume) according to the manufacturer’s instructions (QIAgen, Germany). Up to 200 mg of highly soluble ankyrin repeat domains were purified from one liter of E ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids from each sample were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA yields were measured using a RT-qPCR assay targeting the rdrp gene as previously described[13].
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized and His6-HA-SUMO1-conjugates were enriched on nickel-nitrilotriacetic acid (NiNTA) agarose beads (Qiagen, #L30210) as described in15 ...
-
bioRxiv - Microbiology 2023Quote: ... Extractions of viral nucleic acids from 140 µl samples were performed with the QIAamp Viral RNA Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were moved on magnet and supernatant was transferred to clean 1.5 mL tubes for nucleic acid extraction using the MinElute PCR Purification Kit (Qiagen). Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: We extracted nucleic acids from each 200 μL aliquot using the AllPrep PowerViral DNA/RNA kit (Qiagen, Hilden, Germany) using Glass PowerBead tubes included with the kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was extracted using hot acid-phenol (Uppuluri et al., 2007) and cleaned up using the RNeasy kit (Qiagen). Libraries were prepared using the NuGEN Universal Plus mRNA kit ...
-
bioRxiv - Microbiology 2023Quote: ... Three nucleic acid extraction kits designed for DNA and RNA extraction were compared: DNeasy PowerWater kit (QIAGEN; Hilden, Germany), NucleoSpin Soil ...