Labshake search
Citations for Qiagen :
351 - 400 of 5367 citations for Primary Human Retinal Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Synthetized cDNA was subjected to a PCR array specific for the human antiviral response (RT² Profiler PCR array – PAHS-122Z, SA Biosciences, Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was used for human ISG15 and ISG56 and mouse genes including Gapdh as the housekeeping gene on the Rotor-Gene Q 5plex (Qiagen). RT-qPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Microbiology 2021Quote: ... mRNA-Seq FASTQ reads were mapped to the human reference genome (Homo sapiens v81; hg38) using default options on CLC Genomics Workbench 11 (Qiagen). Total gene reads (with at least 1 read count ...
-
bioRxiv - Genomics 2020Quote: RNA isolation for all the 248 human subjects were performed using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The isolated RNA was subjected to qPCR for determining viral load by Ct values ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from human fibroblasts as well as iNs from the same lines using the miRNeasy kit (Qiagen) followed by Universal cDNA synthesis kit (Fermentas) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 ng of genomic DNA derived from sorted neuronal and non-neuronal nuclei of a postmortem human ACC sample (Brain A) was used for bisulfite conversion (EpiTect Bisulfite Kit, Qiagen). For each sample ...
-
bioRxiv - Cancer Biology 2021Quote: RNA/DNA was isolated from the macro-dissected xenografts (injected/contralateral side, separately) and human GBM (AllPrep DNA/RNA Mini Kit, Qiagen). The ratio of human/mouse cells in the xenografts was estimated by species specific PCR (DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2020Quote: Total DNA samples were obtained from human skin biopsy samples (XX, caucasian, 79 yr) using the QIAamp DNA Mini Kit (Qiagen) and applied to the human Illumina Infinium EPIC 850K chip ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-seq FASTQ data were processed and mapped to the human reference genome (hg38) with the CLC Genomics Workbench 20 (Qiagen). Differential gene expression was analyzed with the DESeq2 package in R (Drummond et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Cancer Biology 2021Quote: Snap frozen primary tumors were prepared for RNA isolation by TRIZOL digestion and subsequent homogenization using a TissueLyser II (Qiagen, Hilden, Germany) with a 5 mm stainless steel bead for 2 min at 30 Hz ...
-
bioRxiv - Cancer Biology 2022Quote: ... paraffin-embedded (FFPE) 4 × 4 μm tissue sections of primary tumors and matched brain metastases using RNeasy FFPE kit (Qiagen, Hilden, Germany) per manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... primary prostate tumor tissue cores (three 20 µm-thick, unstained FFPE sections per patient) using the Rneasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted from primary solution with the removal of genomic DNA by the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). The purity and concentration of extrasted totel RNA were confirmed using a NanoDrop ONE spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human U6 primer used in this experiment was included in the miScript Primer assay kit (Qiagen Inc., Germantown, MD, #218300).
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated from a 23 week human fetal heart using Trizol-based dissociation followed by the RNEasy Mini Kit (Qiagen #74104). cDNA was created from this RNA using the iScript Reverse Transcription Supermix (Bio-Rad #1708840) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was isolated from human buffy coat samples at the Crimson Core facility (Mass General Brigham) using the QIAamp DNA Blood Mini Kit (Qiagen 69504) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Reference plasmids were serially diluted in either PBS buffer or heat-inactivated normal human serum (NHS) and re-extracted using the QIAamp® DNA Blood Mini Kit (Qiagen) per recommended protocol for serum ...
-
bioRxiv - Cancer Biology 2020Quote: Flag-tagged NF1-GRD (aminoacids 1131-1534) was amplified by PCR from human cortical tissue (epilepsy patient) and first cloned in the pDRIVE vector (Qiagen #231124). Primers are listed in Supplementary Table 5 ...
-
bioRxiv - Immunology 2021Quote: ... and ImmunoCult™ Human Treg Differentiation Supplement (StemCell TechnoRNA was isolated at set time points after activation using the RNeasy Mini (Qiagen). cDNA was generated using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... 1 µg of RNA isolated from human islets or 10 µL of exosomal RNA was reverse transcribed using the miRScript II kit (Qiagen, Germany), following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The association of the differentially expressed proteins with specifically dysregulated regulatory/metabolic networks in OT human samples was analyzed using QIAGEN’s Ingenuity Pathway Analysis (IPA; QIAGEN Redwood City). This software calculates significance values (p-values ...
-
Variation in Leishmania chemokine suppression driven by diversification of the GP63 virulence factorbioRxiv - Microbiology 2021Quote: ... Cells were resuspended in RNAprotect Cell Reagent (Qiagen) and stored at -80°C prior to extracting RNA with RNeasy RNA extraction kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were collected in RNAprotect Cell Reagent (Qiagen), and total RNA was extracted using the RNeasy Plus Micro kit (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were then stained by Coomassie-blue or immunodetected as described before [26] using primary polyclonal antibodies directed against His6 epitope-tag (Penta His, Qiagen, dilution 1:1000), V5 epitope-tag (Bethyl Laboratories ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using the ‘Human Innate and Adaptive immune Response’ kit (Qiagen, Hilden, Germany) to assess the expression of genes/mRNA ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from 1 mL of each human plasma sample using the DNeasy Blood and Tissue kit (Qiagen, 69504, Hilden, Germany) according to the manufacturer protocol and recommendations ...
-
bioRxiv - Microbiology 2023Quote: Microbiome DNAs were extracted from the human samples on the same day of collection using the microbiome-specific kit (QIAamp DNA Microbiome Kit; Qiagen, Hilden, Germany). The DNA extraction was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Subsequent targeted sequencing of 160 cancer-related genes was performed using a QIAseq Human Comprehensive Cancer Panel v2 (Qiagen Inc, Valencia, CA) (Table S2) ...