Labshake search
Citations for Qiagen :
351 - 400 of 2287 citations for PEGSSDA 2 x 0.5 mL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: Genomic DNA for the Pacific Bioscience Single Molecule Real-Time (SMRT) sequencing was prepared from 2 mL of fresh blood using the genomic-tip 100/G kit (Qiagen, Hilden, Germany). This was performed with additional RNase (Astral Scientific ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted directly from the frozen samples with the addition of 2 ml of G2 DNA/RNA Enhancer (Ampliqon, Odense, Denmark) using the RNeasy PowerSoil Total RNA Kit (Qiagen, København, Denmark) with phenol:chloroform:isoamyl alcohol following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 600 µl of lysis buffer (TES (0.1 M TRIS, 10 mM EDTA, 2% sodium dodecyl sulphate; pH 8) and Proteinase K (Qiagen, 20 mg/ml) in a 20:1 ratio ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA from about 0.5 million cells were purified with RNeasy Plus Micro (QIAGEN). Around 50,000 cells were washed with PBS and subjected to tagmentation and ATAC-seq described below ...
-
bioRxiv - Microbiology 2019Quote: ... 0.5 μl dNTP mix (dNTP Set, PCR Grade, 10mM each, Qiagen, Hilden, Germany), 0.125 μl Taq DNA Polymerase (5 units/L ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen). qRT-PCR was performed using SsoAdvanced Universal SYBR Green Supermix (BioRad ...
-
bioRxiv - Immunology 2022Quote: ... 0.5 μg of RNA was further processing with RT2 First Strand Kit (Qiagen). cDNA was mixed with RT2 SYBR® Green Mastermix (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... The pellets were mixed with 0.5 g of 1.0 mm glass beads (Qiagen) in a sterile 2 ml safe lock microtube and vortexed horizontally at maximum speed for 10 minutes prior to continuing with the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1% Triton X-100 and homogenized in a TissueLyser II (Qiagen), centrifuged at 20,000 rcf at 4°C for 10 minutes after which the supernatant was collected for multiplexed immunoassay analyses.
-
bioRxiv - Developmental Biology 2023Quote: ... with the carboxy-X-rhodamine (CXR) Dye and Rotor-Gen-Q (Qiagen) detection system ...
-
bioRxiv - Microbiology 2020Quote: ... followed by lysis in a 2 mL sure-lock tube containing 5 mm stainless steel homogenization beads using the TissueLyser LT (Qiagen, Germantown, MD, USA) for 30 seconds at 30 hz followed by 1 min of 30 hz while keeping the sample cold ...
-
bioRxiv - Genetics 2020Quote: ... approximately 30 seeds per genotype were placed in a 2 mL Eppendorf Safe Lock tube along with one stainless steel bead (Qiagen Cat. No. 69989), frozen in liquid nitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Neuroscience 2020Quote: ... filtered lists (|log2 fold change| > 0.5) were analyzed through the use of IPA (QIAGEN Inc. ...
-
bioRxiv - Cell Biology 2021Quote: The mRNAs were isolated from 0.5 million cells using RNeasy Mini kit (Qiagen, 74104); the cDNA was prepared using SuperScript III First-Strand Synthesis SuperMix for qRT-PCR kit (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... Cleaned-up RNA (0.5 µg) was reverse transcribed with Omniscript Reverse Transcription kit (Qiagen) using oligo dT primers in a 20 µL reaction volume ...
-
bioRxiv - Immunology 2022Quote: ... Whole tissue segments (0.5 cm3) were snap frozen dry or stored in RNAlater (Qiagen) for analyses of RNA-seq and tissue viral quantification ...
-
bioRxiv - Cell Biology 2023Quote: ... yeast lipids were extracted in bead-mill tubes (glass 0.5 mm, Qiagen, Hilden, Germany) containing a solution of 230 µl MeOH containing internal standards (Avanti SPLASH LipidoMix ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were transferred to a tube with 0.5 mm glass beads (Qiagen, Germantown, Maryland) and bead beat for 10 min at maximum speed followed by a 30 min incubation at 65°C with shaking ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted plasmid libraries were diluted to 0.5 ng/µL in Buffer EB (Qiagen, 19086) and Kapa Hifi HotStart Ready mastermix (Roche ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from the remaining 2 mL of the cell suspension using the RNeasy® Protect Bacteria Mini Kit (QIAGEN, Cat. No. 74524) following the manufacturer instructions.
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... perfringens cultures (maximum of 1 x 107cells) lysed with lysis buffer (200μl Qiagen Buffer P1 ...
-
bioRxiv - Immunology 2021Quote: RNA was isolated from ~5 x 105 cells using RNeasy mini kits (Qiagen), typically yielding 100-400 ng RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... was used for viral packaging then concentrated using Lenti-X Concentrator (Qiagen, 631232). The titer of the individual lentiviral solution was quantified by Lenti-X p24 Rapid Titer Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Bisulfite conversion was performed on 0.5-1ug of DNA using the EpiTect Bisulfite Kit (Qiagen). Bisulfite-treated DNA was PCR amplified and either cloned and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 μg of total RNA was converted using an RT2 first strand kit (Qiagen, #330401) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was prepared from 0.5-1 μg RNA using a Quantitect Reverse Transcription Kit (Qiagen) and diluted to 2.5 ng/mL in DEPC-treated water ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Animals were homogenized in 80 µl PBS + 0.5% Tween using a Tissue Lyser LT (Qiagen) with small steel beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5 µL of a mixture of spike ins UniSp6 and cel-miR-39-3p (Qiagen) was added to the cDNA reaction ...
-
bioRxiv - Plant Biology 2022Quote: ... The nuclei were embedded in 0.5 % w/v agarose and treated with Proteinase-K (Qiagen) for 2 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Reactions (20 µl) included 0.5 units of Qiagen HotStartTaq (Cat. No. 203207, QIAgen, Hilden, Germany), 0.2 µM primers ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA (0.5 μg) was extracted using the RNeasy Mini Kit (Qiagen, Germantown, MD, USA) from EMBs and reverse transcribed using qScript cDNA Supermix (Quantabio ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 30 uL/well 1 X lysis buffer (1x Qiagen TCL, 1% beta-mercaptoethanol) was added ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was isolated on the Spin X column using RNA Easy Kit (Qiagen, Netherlands) and the DNAse RNase-Free Set (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... 1 x 75 bp next generation sequencing of placental microRNA was performed by Qiagen Genomic Services (Frederick ...
-
bioRxiv - Microbiology 2023Quote: RNA was extract from 8 x 106 cells using the RNeasy Mini Kit (Qiagen) protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Microbiology 2019Quote: ... 9 mL 1M Tris HCl pH 7.5, 9 mL 0.5M EDTA pH 8.0, 11.25 mL 10% SDS, 22.5 mL Qiagen lysis reagent ...
-
bioRxiv - Genomics 2020Quote: ... The nuclei were embedded in 0.5 % w/v agarose followed by treatment with proteinase-K (Qiagen) for 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were trypsinized and 0.5 × 106 cells were plated directly with Effectene transfection mixture (Qiagen, 301427) on 0.1% gelatin (in-house production ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription was performed with 0.5 µ g cRNA using the Omniscript RT mini kit (Qiagen). cDNA amplication was carried out with Light-Cycler 480 SYBR Green I Master mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... siRNAs were then transfected into 2,000 A549 cells in each well using 0.5 μl HiPerFect (Qiagen) in a total volume of 50 μl and a final concentration of 20 nM siRNA ...
-
bioRxiv - Genomics 2022Quote: ... 0.5-1µg of DNA was bisulfite-converted with the EpiTect Fast Bisulfite Conversion Kit (Qiagen, 59824) using two columns per sample according to the manufacturer’s protocol with the following modifications ...