Labshake search
Citations for Qiagen :
351 - 400 of 10000+ citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... cDNA was synthesized using the Sensiscript Reverse Transcription Kit (Qiagen, 205213, Hilden, Germany) or the Omniscript Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... Retro transcription (RT) was performed using the miRCURY LNA RT kit (Qiagen, Germany).
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA was performed using QuantiTect® Reverse Transcription Kit (Qiagen). For qPCR ...
-
bioRxiv - Plant Biology 2024Quote: ... and cDNA was synthesized by QuantiTect Reverse Transcription Kit (QIAGEN, Cat No. 205311). Quantitative RT-PCR was performed with CFX Connect Real-Time PCR Detection System using Maxima SYBR Green/Fluorescein qPCR Master Mix (Thermo Scientific ...
-
bioRxiv - Physiology 2024Quote: ... RNA (1 μg) was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The cDNA was then synthesized with an Omniscript Reverse Transcription (RT) Kit (QIAGEN). Quantitative PCR reactions were carried out in a CFX Connect Real-time PCR detection system (BioRad ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Samples were normalized and underwent cDNA synthesis using QuantiTect Reverse Transcription Kits (Qiagen). qPCR was conducted using SYBR green supermix (Bio-Rad ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: RNA was isolated using Qiagen RNeasy kit and cDNA was generated using the QuantiTect reverse transcription kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2021Quote: ... 600ng RNA were reversely transcribed to cDNA with the Quantitect Reverse Transcription Kit (Qiagen). The RT-PCR experiments were performed as previously described in (36) ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was first reverse-transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA (300ng per sample) was reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen). The resulting cDNA was diluted to a volume of 60μl ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg of RNA was retrotranscribed in cDNA with QuantiTect Reverse Transcription Kit (Qiagen), followed by a PCR amplification of the subsequent transcripts ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal amounts of RNA were reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen). cDNA was amplified with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal amounts of RNA were reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen). cDNA was amplified by standard PCR with the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA samples were reverse transcribed using the QuantiTect Reverse Transcription Kit™ (Qiagen, 205314). qPCR was conducted using custom-made primers (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was prepared from 1 μg RNA using a Quantitect Reverse Transcription kit (Qiagen) and diluted 1:20 in DEPC-treated water ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and reversed transcribed into complementary DNA (cDNA) by QuantiTect® Reverse Transcription Kit (Qiagen) according to the supplier’s protocols ...
-
bioRxiv - Plant Biology 2020Quote: ... The isolated RNA was converted into cDNA using the QuantiTect Reverse Transcription Kit (QIAGEN). The primers used in this study are listed in Table S2 ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed with Quantitect Reverse Transcription Kit (Qiagen) using oligo(dT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal amounts of RNA were reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen). cDNA was amplified with the following primers ...
-
bioRxiv - Plant Biology 2020Quote: ... and first strand cDNA was synthesized using Quantitect reverse transcription kit (Qiagen, Hilden, Germany). Quantitative reverse transcription PCR (qRT-PCR ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA synthesis was carried out using the QuantiTect® Reverse Transcription Kit (Qiagen, UK) using 100 ng RNA per reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was prepared from 500ng of total RNA using QuantiTect Reverse Transcription Kit (Qiagen). SYBR green (see primers list ...
-
bioRxiv - Cell Biology 2021Quote: ... First strand cDNA synthesis was carried out using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1000 ng of RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and converted to cDNA using a QuantiTect® Reverse Transcription Kit (QIAGEN, Hilden, Germany). qRT-PCR of VL30 and γ-RVV mRNA was premised on the same primer/probe sets that were described above ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was first reverse-transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesised from 1g total RNA using the QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Cleaned-up RNA (0.5 µg) was reverse transcribed with Omniscript Reverse Transcription kit (Qiagen) using oligo dT primers in a 20 µL reaction volume ...
-
bioRxiv - Molecular Biology 2020Quote: ... was used for first-strand cDNA synthesis using QuantiTect Reverse Transcription kit (QIAGEN, Germany) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: cDNA was synthesized from ≤ 1µg RNA using the QuantiTect Reverse Transcription Kit (Qiagen, 205311), snap-frozen and stored at −80 °C until further use ...
-
bioRxiv - Cell Biology 2022Quote: ... 1µg of RNA was converted to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real time PCR reactions were performed with cDNA using iTaq Universal SYBR Green supermix (Bio-Rad ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen, DE). Conventional PCR amplification of Gpr116 was achieved using the forward primer 5’ TCCAATTCGAGGGACCGAAG 3’ and reverse primer 5’ GTAGTTCACAACCACGCTGC 3’ ...
-
bioRxiv - Bioengineering 2019Quote: ... cDNA was made from isolated RNA with the QuantiTect Reverse Transcription Kit (Qiagen 205310). RNA-Seq was performed using an Illumina HiSeq 2500 (The Center For Applied Genomics ...
-
bioRxiv - Cell Biology 2019Quote: ... Purified mRNA was transcribed into cDNA with the QuantiTect®Reverse Transcription Kit (Qiagen). Transcripts of complement components ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNAs were synthesized from ∼1 µg total RNA using QuantiTect Reverse Transcription kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... and each sample was reverse transcribed using a QuantiTect Reverse transcription kit (Qiagen, #205313). qRT-PCR reactions were performed with LightCycler 480 SYBR Green I MasterMix (Roche ...
-
bioRxiv - Bioengineering 2020Quote: ... and RNA was reverse-transcribed to cDNA using a QuantiTect Reverse Transcription kit (Qiagen) and a S100 thermal cycler (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA (200 ng) was reverse-transcribed using the QuantiTect Reverse Transcription kit (Qiagen 205313). Quantitative PCR reactions were carried out in duplicates with SYBR Green I Master Mix (Roche S-7563 ...
-
bioRxiv - Genomics 2021Quote: ... and 500ng of mRNA were reverse transcribed using the QuantiTect reverse transcription kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Random-primer reverse transcription was done using RT2 First Strand kits (Qiagen; Valencia, CA), including a genomic DNA removal treatment ...
-
bioRxiv - Immunology 2020Quote: ... The RNA was reverse transcribed to cDNA with the Quantitect Reverse Transcription kit (Qiagen). Gene expression analysis was performed with primer assays from Qiagen [IL-10] and Eurofins [IL-12α ...
-
bioRxiv - Cell Biology 2022Quote: Reverse transcription was carried out using the miRCURY LNA™1 RT Kit (Qiagen) using 10 ng of RNA according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Complementary DNA (cDNA) synthesis was performed using the QuantiTect Reverse Transcription Kit (Qiagen, #205313). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2023Quote: RNA of cells was transcribed to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen): 50-1000 ng RNA were mixed with RNAse-free water and gDNA Wipeout buffer for 2 min at 42°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... using oligo-dT priming and the QuantiTect Reverse Transcription Kit (QIAGEN, Cat No. 205310). Gene expression was measured by quantitative RT-PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... before reverse transcribing to cDNA with the QuantiTect Reverse Transcription kit (Qiagen, Hilden, Germany). All cDNA samples were diluted with PCR-grade ultrapure water to 12.5 ng/µL prior to qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... according to the manufacturer instructions and retrotranscribed with the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real-time PCR reactions (TaqMan and SYBR Green ...
-
bioRxiv - Plant Biology 2023Quote: ... DNase treatment and cDNA synthesis was carried out using QuantiTect Reverse Transcription Kit (Qiagen). Expression of PIF4 and ARP6 was analyzed by semiqunatitative PCR and qPCR ...
-
bioRxiv - Genomics 2023Quote: ... 200ng total RNAs were reverse transcript into cDNA using QuantiTect Reverse Transcription Kit (QIAGEN) according to the manufacturer’s protocol ...