Labshake search
Citations for Qiagen :
351 - 400 of 539 citations for GPR27 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: SW480 cells were transfected with siRNA (Qiagen, Supplementary Table S1) (15 pmol/ 9.6cm2 plate ...
-
bioRxiv - Cancer Biology 2021Quote: ... AllStars Negative Control siRNA (Cat# 1027280, Qiagen, Redwood City, CA, USA) was used as a negative control ...
-
bioRxiv - Cell Biology 2019Quote: OASL was silenced using the FlexiTube siRNA Premix (Qiagen, Cat. # 1027420) for rapid siRNA transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Fkbpl and the AllStars Negative Control siRNA were purchased from QIAGEN. For siRNA knockdown in the live-cell imaging experiments in dual-reporter cells (Figure 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... STHdh cells were transfected with FlexiTube siRNA (5 nmol) from Qiagen (Mm_Csnk2a2 ...
-
bioRxiv - Cell Biology 2021Quote: The sense strand of the following siRNAs was synthesized by Qiagen: 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs targeting the 3’UTR of Arhgap11a were purchased (siRNAflex, Qiagen).
-
bioRxiv - Immunology 2019Quote: ... These and the IRF1 siRNA (duplex UCCCAAGACGUGGAAGGCCAACUUU) were purchased from Qiagen. The siRNA against human Rab2a was purchase from Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with the AllStars Negative Control siRNA (SI03650318, Qiagen) referred as the sictrl throughout the article.
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Individual or pooled 50 nM siRNAs complexed with HiPerFect reagent (Qiagen) were added to the plated cells for 72 hours in antibiotic free complete medium at 37°C in 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... and transfection efficiency control (AllStars Hs Cell Death Control siRNA, Qiagen) in all siRNA assays ...
-
bioRxiv - Cell Biology 2023Quote: Cos7 cells were transfected with siRNA using the HiPerfect reagent (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... A non targeting sequence siRNA (AllStars Negative Control QIAGEN Cat # 10272281) was used as negative control ...
-
bioRxiv - Systems Biology 2023Quote: ... or 4 pmol total negative control siRNA (Allstars negative control, Qiagen), were transfected using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: The siRNAs (listed below) were purchased from Qiagen (Germantown, MD, USA) and were transfected into HEK293T cells using Lipofectamine RNAiMAX transfection reagent (#13778075 ...
-
bioRxiv - Developmental Biology 2023Quote: ... AllStars Negative CTRL siRNA was used as control (Cat#: 1027281, Qiagen). Cells were subjected to transfection 24h after plating ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNAs were used: AllStars negative control (Qiagen cat# 1027281) and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Cell Biology 2023Quote: SUV39H1 and SETDB1 genes were targeted with FlexiTube GeneSolution siRNA (Qiagen). Two independent siRNA pools were generated ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 wells of cell death control (Qiagen AllStars Positive Control siRNA), and 8 wells of YAP targeting siRNA (Ambion Silencer Select ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Neuroscience 2023Quote: ... 50 μM of AllStars Negative Control scramble siRNA (Qiagen Cat.# 1027280) was used as control.
-
bioRxiv - Molecular Biology 2024Quote: ... The following siRNA were transfected at 100 μM using HiPerFect (Qiagen): ATAD5 (HSS129125) ...
-
bioRxiv - Molecular Biology 2024Quote: ... SI03146479 and All Stars negative control SI03650318 siRNAs were from Qiagen. siRNA was transfected with lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The AllStars Negative siRNA non-targeting sequence was purchased from Qiagen (#SI03650318).
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription of siRNAs were preformed with TransMessenger Transfection Reagent (Qiagen, USA). Fluorescently labeled dsRNA oligomer ...
-
bioRxiv - Cell Biology 2021Quote: ... Non-targeting siRNA controls were siC (Qiagen All-Stars negative control,1027281) or siNT1 (D-001810-10-05 ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA transfection was carried out through reverse transfection protocol with HiPerFect (Qiagen). 6μl of 10μM siRNAs targeting human KLC1 or KLC2 were mixed with 12μl HiPerFect in high-glucose DMEM medium (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Biochemistry 2022Quote: TOM20 and TOM7 KDs were induced with FlexiTube siRNA purchased from QIAGEN (SI00301959 and SI04364955 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 12 μL of 20 μmol/L negative control siRNA (QIAGEN, Germantown, MD) or Hs_MAN1B1 siRNA (QIAGEN ...
-
bioRxiv - Immunology 2020Quote: ... The miScript Inhibitor Negative Control and the AllStars Negative Control siRNA (Qiagen) were used as scrambled controls (CT ...
-
bioRxiv - Microbiology 2019Quote: ... each plate contained the same amount of the following siRNAs from Qiagen as knockdown controls ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were reverse transfected with 10nM siRNA (final concentration) using HiPerfect (Qiagen) according to manufacturer’s instruction.
-
bioRxiv - Cell Biology 2021Quote: siRNA for mouse VHL (Flexitube Gene Solution GS22346) was obtained from Qiagen. AllStars negative control siRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Immunology 2020Quote: ... or non-targeting AllStars negative control siRNA (1027280) were purchased from Qiagen. All siRNA transfections were performed using the Lipofectamine RNAiMax reagent (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: siRNAs targeting several exons of CAPG were purchased from Qiagen (Germantown, MD) (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 1 hour and then transfected with siRNAs (Qiagen, Cat. No. 1027417) using lipofectamine RNAiMAX (Thermo-Fisher Scientific #13778 ...
-
bioRxiv - Developmental Biology 2023Quote: FlexiTube siRNA was used to knock-down human PDE2A (Cat#: SI00040159, Qiagen). AllStars Negative CTRL siRNA was used as control (Cat# ...
-
bioRxiv - Immunology 2023Quote: ... was 80 nM and the corresponding scramble siRNA (all start negative, Qiagen) was used as control ...
-
bioRxiv - Molecular Biology 2023Quote: Screen performance was evaluated using AllStars Hs cell death control siRNA (Qiagen) compared to non-targeting control siRNA#2 (Thermofisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The control shRNA (shCtrl) was generated from AllStars Negative Control siRNA (Qiagen), which does not recognize mammalian RNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNAs pre-mixed with 20 μl of HiPerFect transfection reagent (301704, Qiagen) on free-serum media ...
-
bioRxiv - Cancer Biology 2023Quote: ... and compared to a non-targeting siRNA control (Qiagen Allstars Neg Ctrl). 786-O cells were split one day prior to transfection and plated at 50-60% confluency ...
-
bioRxiv - Biochemistry 2023Quote: C2C12 cells were transfected with 200 nM non-target siRNA (siScr, Qiagen) or siNr2f6 (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... we mixed Lipofectamine 3000 and siRNA (Qiagen, Hs_PLCB1_4, SI00115521; Qiagen, Hs_PLCB1_6, SI02781184; Qiagen, Hs_PLCE1_1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection of Sox9 siRNA was conducted by using HiPerFect transfection reagent (#301704, Qiagen).
-
bioRxiv - Molecular Biology 2019Quote: ... mixed D1R and D5R-specific siRNA (#SI00015792, #SI00015869, Qiagen Science Inc., Germantown, MD) or non-silencing “mock” siRNA ...