Labshake search
Citations for Qiagen :
51 - 100 of 539 citations for GPR27 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and paxillin siRNA (Qiagen) were transfected with HiPerfect (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... The AllStar siRNA (QIAGEN) was used for the negative control ...
-
bioRxiv - Cell Biology 2023Quote: ... AllStars siRNA (from Qiagen) was used as negative control ...
-
bioRxiv - Biochemistry 2023Quote: The siRNA constructs (Qiagen) were mixed with 0.14 μL of Lipofectamine RNAiMAX Transfection Reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used to transfect HNRNPK smartpool siRNA (Dharmacon) or non-targeting siRNA (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Neuroscience 2020Quote: NALCN-siRNA and control-siRNA with modification of 3’-AlexaFluor488 (QIAGEN, Maryland, USA) were dissolved in RNase-free water (NALCN-siRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... we used the following siRNAs: All Star Negative Control siRNA (Qiagen, Cat# 1027280), human siSLC9A6 ...
-
bioRxiv - Cell Biology 2021Quote: ... The AllStars Negative Control siRNA and gene-specific siRNAs were purchased from Qiagen and Eurofinns ...
-
bioRxiv - Cell Biology 2019Quote: ... The siRNA targeting rat Psmc1 included Rn_RGD:621097_1 FlexiTube siRNA (Qiagen, Cat# SI02002427) and Rn_RGD:621097_2 FlexiTube siRNA (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific siRNA oligonucleotides for β-catenin and control siRNA were obtained from Qiagen, Caveolin-1 ...
-
bioRxiv - Systems Biology 2020Quote: For RNAi FlexiTube siRNAs against Klf2 were used with AllStars Negative Control siRNAs (Qiagen). 20ng siRNAs/4×104 cells were transfected in 2i using DharmaFect (Dharmacon) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lipofectamine and siRNA (Qiagen, Hs_PLCB1_4, SI00115521; Qiagen, Hs_PLCB1_6, SI02781184; Qiagen, negative control siRNA, 1022076) against target genes with Opti-MEM (31985070 ...
-
bioRxiv - Pathology 2023Quote: ... was used to transfect HMEC-1 with siRNA control or siRNA MC1R oligonucleotides (Qiagen) (20 nM final concentration).
-
bioRxiv - Neuroscience 2024Quote: ... The YTHDF2-specific siRNA and AllStars negative control siRNA (#1027281) were purchased from Qiagen, while the HIF1α-specific siRNA was obtained from Ambion ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1X106 cells were mixed with 5 μl of 20 μM siRNAs (GeneSolution siRNA, Qiagen) and 100 μl of Ingenio electroporation solution (Mirus ...
-
bioRxiv - Genetics 2019Quote: ... siRNA oligos (Qiagen Flexiplate, validated) were complexed first with RNAiMAX (Life Technologies ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: Targeting siRNA was produced (Qiagen) to interact with DNA sequences AAGCAATGAGCTGTTTGAAGA for CHC17 (Esk et al. ...
-
bioRxiv - Physiology 2020Quote: ... using a scramble siRNA (Qiagen, AllStars Negative Control siRNA™ including HiPerFectTransfection reagent ...
-
bioRxiv - Microbiology 2021Quote: ... in 200 μ Opti-MEM I (ThermoFisher).AllStars negative-control siRNA (Qiagen) or ON-TARGET plus SMART pool siRNA targeting AIM2 (no ...
-
bioRxiv - Cell Biology 2020Quote: ... H1299 cells (control siRNA (Qiagen), CD59- or flotillin-depleted ...
-
bioRxiv - Biophysics 2020Quote: ... Hs_TLN2_3 FlexiTube siRNA (Qiagen, SI00109277) and AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... Allstars Negative Control siRNA (Qiagen) was used as a scramble siRNA.
-
bioRxiv - Microbiology 2022Quote: ... AllStars Negative Control siRNAs (Qiagen) were used as negative controls at 10 nM or 30 nM ...
-
bioRxiv - Biophysics 2022Quote: ... The negative siRNA (1027310, Qiagen), siNEG ...
-
bioRxiv - Cancer Biology 2022Quote: siRNAs were purchased from QIAgen or Sigma Aldrich (company-validated ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Genetics 2022Quote: ... siRNAs were obtained from Qiagen: AllStars Negative Control siRNA (Qiagen # 1027280) ...
-
bioRxiv - Cell Biology 2019Quote: ... Allstars negative control siRNA (Qiagen) was used as a control ...
-
bioRxiv - Microbiology 2019Quote: ... A custom siRNA from Qiagen directed against SKIP served as a phenotype-specific control [22] and was spotted on location ...
-
bioRxiv - Cell Biology 2021Quote: siRNAs are purchased from Qiagen.
-
bioRxiv - Molecular Biology 2020Quote: ... AllStars Negative Control siRNA (Qiagen) or a siRNA against Renilla Luciferase (siRL ...
-
bioRxiv - Cancer Biology 2020Quote: ... AllStars negative control siRNA (Qiagen) and ON-TARGETplus non-targeting pool (Dharmacon ...
-
bioRxiv - Cell Biology 2022Quote: ... AllStars Negative Control siRNA (QIAGEN) is used as the control siRNA (siCtrl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Allstars Negative Control siRNA (Qiagen) was used as a negative control (siCTL) ...
-
bioRxiv - Cell Biology 2022Quote: siRNAs were purchased from Qiagen. Cells were transfected using Lipofectamine RNAiMAX Transfection Reagent according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: siRNAs were purchased from Qiagen:
-
bioRxiv - Cancer Biology 2023Quote: ... siRNAs were purchased from Qiagen, including siASCL1-1,-2,-3 (SI00062573 ...
-
bioRxiv - Molecular Biology 2023Quote: ... AllStars siRNA (Qiagen, Venlo, Netherlands) or an siRNA targeting firefly luciferase (46 ...
-
bioRxiv - Cancer Biology 2022Quote: The non-targeting siRNA (Qiagen) and paxillin siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... or control siRNA (Qiagen, #SI03650318) at 90% confluency (24 pmol siRNA per 12 well dish cavity with Lipofectamine RNAiMAX ...
-
bioRxiv - Microbiology 2023Quote: ... or random control siRNA (Qiagen) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... AllStars negative control siRNA (Qiagen) was used as control siRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... siGFP (GFP-22 siRNA, Qiagen), TTLL12-specific siRNAs ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA used as control (siCTRL) was Allstars negative control siRNA (QIAGEN, Cat. No. 1027281). The siRNAs targeting TLNRD1 were purchased from QIAGEN (siTLNRD1#6 ...
-
bioRxiv - Cell Biology 2020Quote: ... DRP1 siRNA (SI02661365) and its negative control Non-coding siRNA (SI03650325) were purchased from QIAGEN. The siRNA transfections were performed with Lipofecatmine RNAiMAX (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Molecular Biology 2019Quote: ... The following day siRNA or scrambled siRNA were mixed in plain DMEM with Hiperfect (Qiagen) and incubated for 10 min at room temperature (RT ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA used as control (siCTRL) was Allstars negative control siRNA (Qiagen, Cat. No. 1027281). The siRNA oligonucleotides targeting swiprosin-1 were purchased from Sigma (siRNA#1 Cat ...