Labshake search
Citations for Qiagen :
351 - 400 of 505 citations for 8 Cyano octanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were extracted from mouse fecal samples and inoculum samples using the DNeasy Powersoil HTP Kit (QIAGEN) and from the further simplified SC2 samples using the Powermag Microbiome kit (MoBio) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5% deoxycholic acid with a protease inhibitor) and pre-cooled tissue homogenizer (TissueLyser LT, Qiagen GmbH, Hilden, Germany) for 2-4 min at 45 Hz ...
-
bioRxiv - Microbiology 2019Quote: ... followed by a standard nucleic acid extraction method using QIAamp genomic DNA Mini Kit (Qiagen Sciences, Maryland, USA), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from up to 500 μl of plasma using QIA amp Circulating Nucleic Acid Kit (Qiagen) and eluted in 15 μl volume ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA was isolated from 2 ml of plasma using either the manual QIAamp circulating nucleic acid kit (Qiagen), or the semi-automated QIAsymphony DSP Circulating DNA Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 700 μl of the supernatant was mixed with 30 μl of nickelnitrilotriacetic acid-agarose (Ni-NTA, Qiagen) for 2 h at RT with mild rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... and the soluble fraction of the lysate was incubated with Ni2+-nitrilotriacetic acid (NTA) beads (Qiagen, Hilden, Germany). Proteins were eluted with 300 mM imidazole in 60 mM NaH2PO4 ...
-
bioRxiv - Microbiology 2023Quote: Total nucleic acids were extracted from half of each sample’s O.2μm filter using DNAeasy PowerSoil Kit (Qiagen). Extraction blanks were run with each round of DNA extractions and all returned no detectable nucleic acids using the maximum amount of blank sample (20μL ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was filtered through a 0.45 μm filter and loaded on a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Microbiology 2023Quote: ... Viral nucleic acids were extracted using the QIAMP® Viral RNA mini kit (60 µL, Qiagen, Venlo, Netherlands) without the addition of carrier RNA ...
-
bioRxiv - Neuroscience 2023Quote: ... Deoayribonucleic acid (DNA) was extracted from stored buffy coat using the Blood Mini DNA kit (Qiagen, Valencia, CA). A TaqMan® single nucleotide polymorphism (SNP ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: DNA was isolated from each of the 8 samples of flies using an adaptation of the Gentra Puregene Cell Kit protocol (Qiagen, 158767). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We extracted RNA from a total of 348 individuals across two early developmental stages (2 days post fertilization (dpf) and 8 dpf) using RNeasy Mini Kits (Qiagen, Inc.). For 2 dpf libraries ...
-
bioRxiv - Neuroscience 2020Quote: DNA and RNA from 8-10 mice was isolated and purified with AllPrep-DNA/RNA/miRNA-universal kit (Qiagen, Montreal, QC) and concentrations were determined by fluorometry on the Qubit system (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 8) and the supernatant was incubated with 80 μl pre-washed Ni-NTA coated Sepharose beads (Ni-NTA agarose, (Qiagen, Hilden) for 90 mins at 4°C on a rolling incubator ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... pods from 8-10 different plants were pooled and RNA was isolated using RNAeasy plant mini kit (Qiagen, Germantown, MD, USA). RNA libraries were prepared using standard Illumina protocols and RNA sequencing was performed using NovaSeq 6000 PE150 by Novogene co ...
-
bioRxiv - Bioengineering 2023Quote: ... DNA was extracted in pools of 6-8 adult mosquitoes mosquitoes using Blood & Cell Culture DNA Midi Kit (Qiagen, Cat# 13343) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Inclusion bodies were solubilized in 8 M guanidine hydrochloride (GdnHCl) and then PrP was captured using Ni-NTA Superflow beads (Qiagen #30410). Bead-bound PrP was refolded on-column using a 4 h gradient from 6 to 0 M GdnHCl and then eluted using a gradient from 0 to 500 mM imidazole ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2019Quote: ... and the supernatant was subjected into 9+ 9_ļ_ Ni2+ -nitrilotriacetic acid (Ni2+ -NTA) agarose resin (Qiagen, Valencia, CA, USA) for affinity chromatography purification ...
-
bioRxiv - Biochemistry 2019Quote: ... Acid-phenol based method was used to isolate total RNA and then purified using RNAeasy mini kit (Qiagen,USA) after a DNAse treatment (TURBO™ DNase ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 mg of freeze-dried and ground roots were mixed with 1.6 mL of 1 M perchloric acid and homogenized in a TissueLyser II (Qiagen) in microtubes containing 6 glass beads of 2.8 mm in diameter ...
-
bioRxiv - Microbiology 2020Quote: ... Extraction of viral nucleic acids from clinical sample was performed with a QIAamp Viral RNA Mini Kit (Qiagen #52906) as described by manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... Nucleic acid was first extracted from each blood sample using QIAamp MinElute Virus Spin kits (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Headless HA stalk proteins were expressed in 293F cells and purified using nickel-nitrilotriacetic acid agarose (no. 1018244, Qiagen) in 5-ml polypropylene columns (no ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acid sequence alignments and a phylogenetic tree of CEC3 homologs were generated using CLC Genomics Workbench8 (QIAGEN bioinformatics).
-
bioRxiv - Microbiology 2022Quote: ... followed by total nucleic acid extraction of 400 ul of pretreated stool using the EZ1 Virus Mini Kit v2.0 (Qiagen). Extracts were eluted in 60 ul volume.
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was collected and was mixed with a small volume of preequilibrated Ni-nitrilotriacetic acid (NTA) beads (Qiagen) for 2 h on a rocking platform at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... PrP was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). In the RT-QuIC assay ...
-
bioRxiv - Neuroscience 2020Quote: ... was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified from inclusion bodies by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). Recombinant hamster PrP (HaPrP ...
-
bioRxiv - Microbiology 2019Quote: Nucleic acids from the seven new isolates were extracted using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) or MasterPure Complete DNA and RNA Purification Kit (Epicentre ...
-
bioRxiv - Biochemistry 2021Quote: ... The ankyrin repeat domains were purified over a Ni-nitrilotriacetic acid column (2.5 ml column volume) according to the manufacturer’s instructions (QIAgen, Germany). Up to 200 mg of highly soluble ankyrin repeat domains were purified from one liter of E ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids from each sample were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA yields were measured using a RT-qPCR assay targeting the rdrp gene as previously described[13].
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized and His6-HA-SUMO1-conjugates were enriched on nickel-nitrilotriacetic acid (NiNTA) agarose beads (Qiagen, #L30210) as described in15 ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were then lysed and the nucleic acid was extracted using Qiagen Allprep DNA/RNA Mini Kit (Qiagen). Aliquots of DNA were sent to Novogene Co ...
-
bioRxiv - Microbiology 2022Quote: ... protein enrichment and purification was performed as in(Bertani et al., 1999) using a Ni2+ nitriloacetic acid metal-affinity column according to the manufacturer’s instructions (QIAGEN). Proteins were resolved by tricine-SDS-PAGE (Schägger ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant was harvested at day 4 after transfection and incubated with Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The purification was carried out using gravity flow column and eluted with imidazole-containing buffer as previously described57,58 ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was extracted using hot acid-phenol (Uppuluri et al., 2007) and cleaned up using the RNeasy kit (Qiagen). Libraries were prepared using the NuGEN Universal Plus mRNA kit ...
-
bioRxiv - Microbiology 2023Quote: ... Extractions of viral nucleic acids from 140 µl samples were performed with the QIAamp Viral RNA Mini Kit (Qiagen), according to the manufacturer’s protocol ...