Labshake search
Citations for Qiagen :
301 - 350 of 505 citations for 8 Cyano octanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Nucleic acid was extracted from the supernatant using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions with modifications ...
-
bioRxiv - Genetics 2021Quote: Relative telomere length of MDS patients was measured by quantitative polymerase chain reaction (qPCR) as previously reported.8 K562 cell DNA was extracted using the QIAamp Blood Mini kit (Qiagen). Telomere length was measured by two orthogonal methods ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pH 5.8) under long day condtions (16h light) at 24 °C (day) 22 °C (night) using the DNeasy Plant Kit (Qiagen). ONSEN copy numbers were determined by qPCR using 12 ng total DNA using the KAPA SYBR FAST master mix universal on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... after adding 1.0 x 10^8 copies/μL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Cancer Biology 2021Quote: All RNA was extracted from pellets of cultured cells (passage numbers ranging from 8-14) and cryosections of snap frozen tumor material with the RNeasy Plus Mini Kit (Qiagen).
-
bioRxiv - Genetics 2021Quote: ... The gDNA pellet was dissolved in 1mL TE pH 8 buffer and incubated with RNase A with a concentration of 100ug/mL (Qiagen) for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Immunology 2021Quote: Total RNA was isolated from HLMEC after 8 h of NP exposure with the RNeasy Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... cells were lysed in TE buffer (pH=8) supplemented with 1 mg/ml of lysozyme and 10 µl of proteinase K (Qiagen) for 10 minutes at room temperature with a shaking of 500 rpm ...
-
bioRxiv - Cancer Biology 2021Quote: Genomic DNA was prepared from cryosectioned material by dissolving 8-μm sections in Buffer AL and purifying with the DNeasy Blood & Tissue kit (Qiagen). Whole-exome sequencing at 100x coverage was performed as a contract service with Genewiz ...
-
bioRxiv - Neuroscience 2021Quote: A total of 8 frozen brain samples (five controls and three infected with ZIKV) were processed in TissueLyser® (Qiagen) for 30 seconds at 30Hz for cell disruption ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
The mitochondrial genome of the red icefish (Channichthys rugosus) casts doubt on its species statusbioRxiv - Zoology 2022Quote: A small piece of muscle tissue (5.8 mg dry weight) was dried in a vacuum centrifuge and immersed in lysis buffer (260 μL ATL buffer (Qiagen) and 40 μL Proteinase K [20 mg/mL]) ...
-
bioRxiv - Microbiology 2022Quote: For RNAseq the pellets were resuspended in 150 µL 10 mM Tris-HCl pH 8 and mixed with 700 µL of ice cold RLT+BME (RLT buffer (Qiagen) supplemented with 1% β-mercaptoethanol ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Microbiology 2019Quote: A549 or DF-1 cells in 6-well plates were infected with the specified IAVs and total RNA was extracted 8 hpi using a RNeasy Kit (Qiagen). Total RNA was eluted in RNase-free water and stored at −80 °C until needed.
-
Revisiting a GWAS peak in Arabidopsis thaliana reveals possible confounding by genetic heterogeneitybioRxiv - Genetics 2021Quote: ... total RNA was extracted from aerial parts of nine-leaf stage seedlings collected at 8 h after dawn using RNeasy mini kit (Qiagen) with DNase treatment (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... 25 nuclei were sorted into each well of 96-well plates (8-10 plates per experiment) containing 12 µl of nuclear lysis buffer (11 µl of EB buffer (Qiagen) supplemented with 0.5 µl of 100X BSA and 0.5 µl of 1% SDS) ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA for PIWIL3 5′ RACE was extracted from the ovaries of 8-week-old golden hamsters using ISOGEN (Nippon Gene) and RNeasy (Qiagen). 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio ...
-
bioRxiv - Cell Biology 2020Quote: The validated Alx1DN (N-terminal portion of protein product containing homeodomain and nuclear localization domains) clones in pCS2+8 were purified via miniprep (Qiagen) alongside a control (C-terminal portion containing transactivation domain) ...
-
bioRxiv - Genetics 2019Quote: ... in each well of 8-stripped PCR tubes by shaking with a zirconia bead (2 mm in diameter, Nikkato, Japan) in TissuLyser II (Qiagen) for 30 s at 30 Hz ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was harvested following an 8 hour DMSO or 10 nM E2 induction with buffer RLT plus (Qiagen, 1053393) supplemented with 1% beta-mercaptoethanol (Sigma Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... 8 cm of leaf tissue was harvested on ice and then lyophilized using a TissueLyser II (Qiagen, Valencia, CA, USA). Genomic DNA was extracted using a Qiagen DNeasy Plant Mini Kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA was isolated 3 or 8 days after editing by a QIAamp DNA Mini Kit or Micro Kit (QIAGEN). The genomic region flanking the CRISPR/Cas9 cleavage site was PCR-amplified ...
-
bioRxiv - Plant Biology 2023Quote: Total cellular RNA was extracted from 8-day-old wildtype or mutant seedlings grown on 1/2MS medium with RNeasy Mini Kit and QIAshredder (Qiagen). Three independently prepared samples with RNA integrity number greater than 8.0 from each line were sequenced and analyzed at The Centre for Applied Genomics at SickKids Hospital (Toronto ...
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Microbiology 2023Quote: ... pH was adjusted to 8 after resuspension to allow the binding of 6x His-tagged toxins to Ni-NTA agarose resin (reference: 30210; Qiagen). Resulting samples were passed through chromatography columns containing the Ni-NTA agarose resin and were eluted with denaturing buffer containing increasing concentrations of Imidazole (10 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from Arabidopsis seedlings (8 seedlings per sample) using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) 24 h after the elicitor treatment ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Microbiology 2023Quote: ... an unbiased amplification method was employed by amplifying the purified DNA at 30°C for 8 hours using a REPLI-g Single Cell kit (Qiagen). The amplified DNA was purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: ... After ligation nuclei were pelleted and resuspended in cold PBS with DAPI to a final concentration of 300nM and GFP+ cells were FAC-sorted into a 96 well plate with 2ul lysis buffer (20mM Tris pH 8, 20mM NaCl, 0.15% Triton X-100, 25mM DTT, 1mM EDTA, 500nM Carrier ssDNA, and 15ug/mL Qiagen Protease) and lysed for 1 hour at 50°C and inactivated 15 minutes at 70°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was isolated from flash frozen 8 μm thick sections of tibialis anterior muscles embedded in OCT using the RNeasy Mini Kit (Qiagen) and evaluated using the RNA high sensitivity kit (Agilent RNA 6000 Pico Kit ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 75 ng of rRNA was reverse transcribed and amplified with 8 PCR cycles using the OneStep RT-PCR kit (Qiagen) and primers MS2_quant_F and MS2_quant_R (Supplemental Table 5) ...
-
bioRxiv - Microbiology 2024Quote: ... samples were resuspended in 100 μl TE buffer pH 8 and RNA extraction performed according to the RNeasy Mini Kit (Qiagen) protocol with few modifications ...
-
bioRxiv - Biochemistry 2023Quote: ... SUMO protease was added at a final concentration 1/10 and the mixture was dialyzed overnight at 4 °C against the buffer DB6 (50 mM Tris-HCl pH 8, 150 mM NaCl, 10 mM imidazole) and applied on a NiNTA column (Qiagen) equilibrated in the DB6 buffer ...
-
bioRxiv - Biophysics 2020Quote: ... proteins were expressed in Escherichia coli strain BL21 (DE3) and purified via nickel-nitrilotriacetic acid affinity chromatography (Qiagen) followed by ion exchange chromatography on an Äkta system (GE Healthcare) ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... or from 1 mL plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN, Cat. No.: 55114, QC for short) following the manufacturer’s guide ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 mL of plasma were thawed and cfDNA extracted using the QIAamp® Circulating Nucleic Acid Kit (Qiagen) according to the manufacturer’s protocol and stored at −20°C until use ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with 12.5 or 6.25nM locked nucleic acid (LNA) miRNA inhibitors (miR-194 LNA inhibitor or negative control inhibitor; Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acids were extracted using QIAamp 96 virus Qiacube HT kit on QIAxtractor Automated extraction (Qiagen, US) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Nucleic acids were isolated via chloroform extraction and RNA was isolated with the Qiagen RNEasy Mini (Qiagen #74104) including on-column DNase I digestion ...
-
bioRxiv - Plant Biology 2020Quote: ... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted from 140 ul of sample fluid using the QIAamp RNA Viral kit (Qiagen) and eluted with 30 ul of DEPC-treated water ...