Labshake search
Citations for Qiagen :
351 - 400 of 4378 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were homogenized in 300 µL Optima™ water for 2 x 2 min at 25 Hz using a TissueLyser bead mill (QIAGEN). Another 650 µL Optima™ water was added ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl diluted cDNA (1:20) were added to SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) and 10 μM of both forward and reverse primer (Primer Sequences Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were homogenized for 2 × 1 min at 30 Hz using a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until further processing.
-
bioRxiv - Molecular Biology 2022Quote: ... and 1-2 µg of RNA was used for the cDNA synthesis (Omniscript RT Kit (Qiagen, 205111)) ...
-
bioRxiv - Immunology 2020Quote: ... in purity mode into 96-well microplates containing 10 μL of 1% 2-mercaptoethanol RLT buffer (Qiagen) and stored at −80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA was isolated from 1-2 mm tail tissue using the DNeasy Blood and Tissue Kit (Qiagen) following the protocol for isolation of DNA from animal tissues and was eluted in 100 µl H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1; siArf1#1 Cat. No. SI02654470; siArf1#2 Cat. No. SI00299250; Qiagen Flex-iTube IRSp53 siRNA#1 Cat ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were homogenized (2 x 1 min at 30 Hz) by a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until next step ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
bioRxiv - Molecular Biology 2024Quote: ... filtered and incubated with Ni-NTA Agarose (Qiagen, 1 mL slurry per 2 L of cell culture) for 1h ...
-
bioRxiv - Microbiology 2020Quote: ... followed by lysis in a 2 mL sure-lock tube containing 5 mm stainless steel homogenization beads using the TissueLyser LT (Qiagen, Germantown, MD, USA) for 30 seconds at 30 hz followed by 1 min of 30 hz while keeping the sample cold ...
-
bioRxiv - Immunology 2023Quote: ... 120 mg l− 1 sodium pyruvate and 1% penicillin–streptomycin) at 300 Hz for 2 minutes using a TissueLyser II (Qiagen, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) are added to one volume of bacterial culture ...
-
bioRxiv - Neuroscience 2024Quote: ... [2] or QIAzol® Lysis reagent (Qiagen, #cat 79306) following vendor’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... packed with 2 mL Ni-NTA agarose resin (Qiagen) pre-equilibrated with 15 mL lysis buffer ...
-
bioRxiv - Systems Biology 2024Quote: ... and 16.7% (v:v) Proteinase K (Qiagen, 19131, 2 mL). The suspension was then incubated at 37 ℃ for 15 minutes at 500 r.p.m.
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL Ni-NTA resin (Qiagen, Cat. # 30210) was equilibrated with 10 mL of 1X Base buffer and 5 mM β-mercaptoethanol for 10 min by constantly rotating ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sample incubated with 2 NiNTA resin (Qiagen, USA). Protein samples were allowed to bind for 4 hr ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Systems Biology 2020Quote: ... was prepared by centrifuging a cell culture at 5525xg for 2 minutes at 4°C then resuspending cells in 1mL of PBS-RNAprotect (333 μL RNAprotect Bacteria Reagent [76506, Qiagen, Hilden, Germany], 666 μL PBS). For immediate RNA stabilization by RNAprotect (Fig ...
-
bioRxiv - Developmental Biology 2024Quote: ... thresholds were used to prepare Reduced Representation Bisulfite Sequencing (RRBS) libraries using the Ovation RRBS Methyl-Seq System 1-16 (NuGen) and the EpiTect Fast DNA Bisulfite kit (Qiagen). Libraries were sequenced using the NextSeq500 platform (Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C) and the supernatant was loaded onto a Ni-nitrilotriacetic acid (NTA) column (Qiagen, Hilden, Germany). After a washing step (6 M urea ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2 min at 40 Hz using TissueLyser LT (Qiagen). 500 µl PBS-tween (0.01% ...