Labshake search
Citations for Qiagen :
601 - 650 of 4378 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 2 mL of RNAprotect bacterial reagent (Qiagen; 76506) and incubated at room temperature for 5 minutes prior to storage at - 80°C until further processing ...
-
bioRxiv - Genomics 2023Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen, no. 30250) and kept on a rotator at room temperature for 1 h.
-
bioRxiv - Cancer Biology 2023Quote: ... consisting of 10 μl of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 7.2 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2023Quote: ... Ishikawa and Caco-2 cell lines were transfected with 20 nM siRNA (Qiagen) using JetPRIME (Polyplus Transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol and then purified using the RNeasy mini kit (QIAGEN) for the QIAcube connect (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... for Day 0 and 2 analyses or AllPrep DNA/RNA Mini Kit (Qiagen) for Day 4 and 6 analyses ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR-2 products were pooled based on concentrations from capillary electrophoresis (QIAxcel, Qiagen). Final libraries were quantified by Qubit dsDNA High Sensitivity assay (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... The tissue was fully homogenized in 2 ml of QIAzol buffer reagent (Qiagen) on ice and Dounce homogenization ...
-
bioRxiv - Microbiology 2024Quote: ... Data were analyzed by the 2-ΔΔCT method using HPRT and GAPDH (Qiagen) as control genes and expressed as fold change compared to control cells without bacteria ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were harvested 2 days later using RNEasy Plus Mini Kit (Qiagen, 74134) with QIAshredder (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in 2 mL of RNAprotect bacterial reagent (Qiagen; 76506) and incubated at room temperature for 5 minutes prior to storage at - 80°C until further processing ...
-
bioRxiv - Microbiology 2024Quote: ... products were digested with restriction enzymes (Table 2) and purified (Qiagen PCR purification). Following triple ligation into pJB38 ...
-
bioRxiv - Pathology 2024Quote: ... 2) TRIzol method versus TRIzol method plus RNeasy clean-up (QIAGEN, Hilden, Germany).
-
bioRxiv - Immunology 2020Quote: ... Samples were diluted at 4:1 (elution buffer (Qiagen)/cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Nickel nitrilotriacetic acid (Qiagen) agarose beads were washed in TBS and added to filtered supernatant at a ratio of 2-3 mL resin/L and incubated on a rotator over-night at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... for GST-tagged CMK-1 variants or nickel-nitrilotriacetic acid beads (Ni-NTA, Qiagen) in the presence of 15 mM imidazole for TAX-6-His6 protein binding ...
-
bioRxiv - Bioengineering 2024Quote: ... the extraction of total nucleic acid from transfected MOLT-4 cells (small scale, as described) was performed using a DNeasy Blood and Tissue Kit (QIAgen catalog # 69504) which includes direct lysis with proteinase K treatment ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... RAGE-/- and SOD1G93A x RAGE-/- mice (n = 5 - 6) using RNeasy Lipid Tissue extraction kit according to manufacturer’s instructions (QIAGEN, CA, USA). The total RNA was purified from genomic DNA contamination using Turbo DNase treatment (Ambion ...
-
bioRxiv - Physiology 2023Quote: ... RNA was pooled from 3-4 wells of an MEA plate and then extracted using the miRNeasy kit (Qiagen). RNA levels were measured using the nanoString nCounter® PlexSet™ (nanoString ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from TG and NTG mice (n=4/group) at 6 months of age using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... collected into an Eppendorf tube and centrifuged at 11200 rpm at 4 °C for 6 min followed by pellet resuspension with 200 μl of QIAzol (Qiagen, Hilden, Germany). To isolate EC from the bottom layer ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and run on the RT^2 First Strand Kit (Stem cell PCR array) (Qiagen). The array was run in triplicate (N=3 ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA (2 μg) was extracted from MPB with the RNeasy Mini Kit (Qiagen) and then reverse-transcribed using the First Strand cDNA Synthesis Kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 300 mM of NaCl and 2 μL of RNase A (0.5 mg / mL) (Qiagen) were added to the collective eluates which were incubated at 65 °C overnight ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Neuroscience 2020Quote: ... and agitated at 30 HZ for twice 2 minutes in the TissueLyser II (Qiagen). RNA isolation was performed on the QIAsymphony (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were then treated with RNase A (2 mg/ml in water, Qiagen, 19101) for 2 hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: The supernatant was mixed with 2 mL Ni-NTA resin (Ni-NTA agarose; Qiagen) pre-equilibrated with buffer A200 (50 mM Tris pH 7.6 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed with 27G1/2 needles and then homogenized with QiAshredder columns (Qiagen). Total RNA from triplicate experiments were purified with the RNAeasy Plus Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2020Quote: ... mechanically homogenized and further lysed in RLT buffer with 2-mercaptoethanol on TissueLyser (Qiagen) with 3 mm beads then extracted according to the protocol using RNeasy Mini Kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... The cleared lysate was run through Ni+2-NTA agarose beads (Qiagen [QA], 30250) to allow binding of the histidine-tagged (recombinant ...
-
bioRxiv - Cell Biology 2021Quote: ... before adding it to 2 ml of Strep-Tactin superflow resin (Qiagen, Hilden, Germany) which was pre-equilibrated with 10 ml lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... and homogenized for 2 cycles with a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 3 min each ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Microbiology 2022Quote: RNA was isolated from 2 x 106 cells using RNeasy plus mini Kit (Qiagen). Reverse transcription was performed with either random decamers or HIV antisense-specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc., CA) operated at 25-30 Hz for four minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cell lysate supernatant was passed through a Ni+2-NTA resin column (Qiagen), and protein was purified following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Feces samples were homogenized for 2 min at 25 Hz in a TissueLyzerII (Qiagen) using metal beads ...
-
bioRxiv - Cell Biology 2020Quote: ... CLEC-2-expressing or PDPN KO FRCs were transfected using Attractene Transfection Reagent (Qiagen) with one or both of the following plasmids ...
-
bioRxiv - Immunology 2021Quote: ... The product was run on a 2% gel and purified by gel extraction (Qiagen). Purified product was amplified using primers index3 and index6 ...