Labshake search
Citations for Qiagen :
351 - 400 of 1714 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was extracted using the Qiagen RNA nucleic acid extraction kit (Qiagen, Hilden, Germany) at 0- ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2024Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Microbiology 2024Quote: ... using stainless steel beads (5 mm; Qiagen). RNA was then extracted using a RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Genetics 2023Quote: ... 5 ul of 5X Q-solution (Qiagen), 1 ul of 5 mM 7-deaza-dGTP (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mm diameter stainless steel bead (Qiagen) was added to all the tubes and the tissue was homogenised in TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stainless-steel beads (5 mm, Qiagen) before RNA isolation using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 µL Multiplex PCR Master Mix (QIAGEN) and a primer mix (each primer at a final concentration of 0.2 µM) ...
-
bioRxiv - Genetics 2020Quote: ... AC7594-5’-CCGCCTATCCTCGTCATGAAC)andcontrolALG9primers(AC5067-5’-CACGGATAGTGGCTTTGGTGAACAATTAC;AC5068-5’-TATGATTATCTGGCAGCAGGAAA GAACTTGGG) (0.5 µM) and QuantiTect SYBR Green PCR master mix (Qiagen) on a StepOnePlus Real-Time PCR machine (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: RNA extraction from sorted CD8 T cell populations pooled from 5-7 mice (week 5 and 8 p.i.) was performed using the RNeasy Plus mini kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Cell free DNA was extracted from 850μl serum using the QIAamp Circulating Nucleic Acid Kit (Qiagen) and was quantified by TaqMan Real-time PCR (StepOneTM Plus Real-Time PCR System ...
-
bioRxiv - Biochemistry 2022Quote: ... The soluble fraction was loaded onto a column packed with Ni(II)-nitriloriacetic acid agarose (Qiagen) pre-equilibrated in 100 mL of binding buffer (50 mM potassium phosphate at pH 7.0 ...
-
bioRxiv - Biochemistry 2020Quote: ... The soluble lysate fraction was bound in batch to nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The resin was washed extensively with 20 mM Tris ...
-
bioRxiv - Biochemistry 2020Quote: ... The soluble lysate fraction was bound in batch to nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The resin was washed extensively with 20 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM PMSF and the resulting supernatant was incubated with nickel-nitrilotriacetic acid agarose (QIAGEN) overnight at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... lysed and incubated with nickel-nitrilotriacetic acid beads as per the manufacturer instructions (Qiagen, Hilden, Germany). Beads were washed ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted using the Qiagen QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany), substituting carrier RNA with linear polyacrylamide (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids were isolated from cell lysates or lung homogenates using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The complete amino acid sequences were aligned by the CLC Genomics Workbench software version 11.0.1 (QIAGEN) (default parameters with very accurate ...
-
bioRxiv - Molecular Biology 2020Quote: ... the collected eluate was incubated with pre-washed nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen) for 90 min at 4°C to remove the His-tagged TEV protease ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from 2OD of cells using acid phenol and purified using RNeasy kit (Qiagen). Reverse transcription was performed on 750ng of RNA using SuperScript III First-Strand Synthesis SuperMix (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: HUVECs were transfected at 60% confluency with 10 nmol/L locked nucleic acid (LNA) GapmeRs (Qiagen) or small interfering RNAs (siRNAs ...