Labshake search
Citations for Qiagen :
451 - 500 of 1714 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and 5-mm stainless steel beads (Qiagen #69989). RNA purification was performed using the NucleoSpin RNA kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2020Quote: ... 5×106 PBMCs were resuspended in RLT (Qiagen) and incubated at room temperature for 10 min prior to storage at –80°C ...
-
bioRxiv - Physiology 2020Quote: ... with 5 mm beads in RLT buffer (Qiagen) containing 1% β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5 mm diameter stainless steel beads (Qiagen) and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 2U/μL Turbo DNase (Qiagen), and 1 μL of 10 mg/mL RNase A (Qiagen) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
A conserved RNA switch for acetylcholine receptor clustering at neuromuscular junctions in chordatesbioRxiv - Developmental Biology 2024Quote: ... 5 U/μL HotStarTaq Plus DNA polymerase (Qiagen) (0.4 μL ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with 5-mm stainless steel beads (Qiagen #69989). RNA extraction was carried out with the NucleoSpin RNA kit (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2024Quote: QIAcuity Probe 5 mL PCR Kit (Qiagen, 250102)
-
bioRxiv - Neuroscience 2024Quote: ... 5 mm stainless steel beads (Qiagen, Hilden, Germany) and a TissueLyser (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: Nucleic acid material remaining in ECM preparations was isolated using a DNeasy Blood & Tissue Kit (Qiagen, Germany). The amount of DNA was quantified using Qubit Fluorometric Quantification.
-
bioRxiv - Bioengineering 2021Quote: The soluble fraction of the cell lysate was mixed with Ni2+-nitrilotriacetic acid agarose beads (Qiagen, USA), and the His6-tagged recombinant proteins were purified by immobilized metal affinity chromatography (IMAC ...
-
Structural Basis for SARS-CoV-2 Envelope Protein in Recognition of Human Cell Junction Protein PALS1bioRxiv - Biochemistry 2021Quote: ... the supernatant was collected for affinity purification by nickel-nitrilotriacetic acid affinity chromatography (Ni-NTA, Superflow, Qiagen). The eluate was concentrated and buffer exchanged for tag removal by incubation with TEV protease overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleic acid was extracted from cell culture media manually using a QIAamp Viral RNA Mini Kit (QIAGEN) or using NucliSENS easyMAG or EMAG platforms (both BioMérieux) ...
-
bioRxiv - Microbiology 2021Quote: RNA was purified by acid phenol-chloroform extraction and column purified (RNeasy mini kit QIAGEN REF 74104) from HFFs grown in media with or without Pan and/or infected with wild-type RH parasites (grown in regular or Pan-depleted media) ...
-
bioRxiv - Microbiology 2020Quote: ... using the MagAttract 96 cador Pathogen Kit in a BioSprint 96 nucleic acid extractor (Qiagen, Hilden, Germany), according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid extractions were performed by combining equal amounts of Lysis Buffer RLT (Qiagen, Germantown, MD, USA) with supernatant from clinical samples (swabs ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid extractions were performed by combining equal amounts of Lysis Buffer RLT (Qiagen, Germantown, MD, USA) with supernatant from clinical samples (swabs ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from supernatants and pellets using the QIAamp Viral RNA Mini Kit (52906, Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... https://www.beiresources.org/).Protein was purified using gravity flow purification with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen, Germany) and concentrated and buffer exchanged in Amicon centrifugal units (EMD Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: The MS2 RNA was purified from the phage particles using QIAamp Circulating Nucleic Acid Kit (Qiagen, Germany) accordingly to the manufacturer’s protocol and stored at −80°C.
-
bioRxiv - Molecular Biology 2021Quote: ... The MBP eluate was then incubated with pre-equilibrated nickel-nitriloacetic acid resin (Ni-NTA agarose, Qiagen) for 60 mins in the presence of 20 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: Locked Nucleic Acids (LNA) and miRNA mimics and scrambled LNA/mimic (negative control) was purchased from Qiagen and MOLM13 cells were transfected with either LONZA nucleofector devise (program X-001 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... 24 and 48 hours and nucleic acid extracted using Qiamp viral RNA mini extraction kit (Qiagen, #52904). Viral DNA levels were quantified by qPCR using primers and probe that detect the ASFV VP72 gene52 with the Quantifast Pathogen PCR kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from brain regions was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Microbiology 2021Quote: ... and supernatants were collected for affinity purification over pre-equilibrated nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) columns ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 and 0.1 μg) were allowed to bind 30 μl of nickel-nitrilotriacetic acid-agarose beads (QIAGEN) for 1 hour after which unbound decoy was removed by washing with PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... The subsequent isolation of nucleic acids was performed using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acid was extracted from the supernatant using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions with modifications ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids (both RNA and DNA) were extracted with the QIAamp Viral RNA Minikit (Qiagen; CA).
-
bioRxiv - Developmental Biology 2023Quote: ... DNA from brain regions was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The cleared lysate was then mixed with nickel-nitrilotriacetic acid (Ni-NTA)-agarose beads (QIAGEN, Hilden, Germany) or glutathione (GSH ...
-
bioRxiv - Cancer Biology 2023Quote: ... The diluted plasma was recovered and processed for cfDNA isolation by QIAmp Circulating Nucleic Acid kit (Qiagen) [16].
-
bioRxiv - Microbiology 2023Quote: ... and nuclease treated prior to viral nucleic acid extraction with the QIAamp viral RNA mini kit (Qiagen) (Chong et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C) and the supernatant was loaded onto a Ni-nitrilotriacetic acid (NTA) column (Qiagen, Hilden, Germany). After a washing step (6 M urea ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... the 3’ adaptor sequence (AACTGTAGGCACCATCAAT) was trimmed based on vendor’s recommendation (Qiagen). After adaptor trimming ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2024Quote: Colon tissue fragments (3 mm, proximal colon) were stored in RNAlater (Qiagen) overnight at 4c ...