Labshake search
Citations for Qiagen :
3551 - 3600 of 6247 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... for 30 min at RT followed by the steps as described in the protocol of Dneasy Blood & Tissue Kit (QIAGEN). 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed and incubated in Proteinase K (Roth) and Ribonuclease A (Roth; 5 min, RT) before isolating cellular and viral DNA with DNeasy Blood & Tissue Kit (Qiagen). qPCR was performed using FastStart Universal Probe Master (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 100 µL DTT (100 mM) at RT for 5 min and recovered by the RNeasy clean up kit (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... were normalized at 10 ng/µL and the reverse transcription of RNA was done following the manufacturer instructions (miRCURY LNA RT Kit, Qiagen). We added 0.5µl of controls UniSp6 and cel-mir-39-3p to the samples as internal reference to check the efficiency of the reverse transcription and PCR amplification ...
-
bioRxiv - Neuroscience 2023Quote: ... After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen) as described in the user manual ...
-
bioRxiv - Microbiology 2021Quote: ... Each gene segment was amplified using segment-specific primers and extracted from 1% gel slices using Qiagen Gel Extraction Kit (Qiagen, Germany). Purified gene segments were cloned into the plasmid pHWSccdB as previously done (27) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was transcribed using reverse primer targeting the conserved termini of influenza gene segments and the Omniscript Reverse Transcription Kit (Qiagen, Germany). Each gene segment was amplified using segment-specific primers and extracted from 1% gel slices using Qiagen Gel Extraction Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2019Quote: ... 25-50ng cDNA and 10 pmol gene specific primer were used in a 10 μl SYBR green reaction mix (Qiagen, 204056) for Quantitative RT-PCR (Supplemental Table 1 ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using the QIAseq SARS-CoV-2 Primer Panel V2 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using QIAseq SARS-CoV-2 Primer Panel V1 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Biochemistry 2020Quote: ... The primers used for pyrosequencing were designed based on a previous study25 using PyroMark Assay Design 2.0 (Qiagen, Valencia, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... analysis carried out with Pb18SrRNA primers for the total RNA isolated from 30 mg tissue of the organs using RNeasy Plus Mini Kit (Qiagen, 74134). After normalizing with respect to the parasite load ...
-
bioRxiv - Immunology 2022Quote: ... DNA synthesis reaction was carried out in 100 μl using 10 pmol of each primer with HotStarTaq Plus DNA Polymerase (Qiagen, 203603). Purified dsDNA products were amplified with 10 pmol of each primer in a 100 μl total reaction volume ...
-
bioRxiv - Cell Biology 2024Quote: ... 500ng total RNA were transcribed into complementary DNA using oligo-dT primers and OmniScript® Reverse Transcription kit (QIAGEN, Hilden, Germany). Transcription levels of genes of interest were assessed by quantitative PCR (qPCR ...
-
bioRxiv - Physiology 2024Quote: ... Reverse transcription of RNA into cDNA was performed by M-MLV reverse transcriptase and oligo(dT) primers (Qiagen, Toronto, ON, Canada). cDNA was then amplified using aCFX384 Touch Real-Time PCR Detection Systems (Bio-Rad ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... and 25 pmol primers in a 25 μL reaction volume and subjected to qPCR using Rotor-Gene Q (Qiagen, Venlo, Netherlands). We amplified the tdTomato gene sequence for vector genome quantification using the following primers ...
-
bioRxiv - Physiology 2023Quote: ... Reverse transcription of RNA into cDNA was performed by M-MLV reverse transcriptase and oligo(dT) primers (Qiagen, Toronto, ON, Canada). cDNA was then amplified in a CFX384 Touch Real-Time PCR Detection Systems (Bio-Rad ...
-
bioRxiv - Bioengineering 2020Quote: ... Approximately 150 mg FW of frozen plant material was disrupted with a glass and a metal bead (Ø 3 mm; QIAGEN GmbH, Hilden, Germany) in a TissueLyser (MM400 ...
-
bioRxiv - Genetics 2020Quote: ... PCR reactions were cleaned up to remove unamplified circular plasmid template by gel extraction followed by digestion with DpnI and a PCR cleanup reaction (Qiagen PCR Purification kit). Mat a yeast were then transformed with the cloNAT resistance cassette ...
-
bioRxiv - Developmental Biology 2021Quote: DNA fragments amplified by PCR and sequenced either directly after performing a clean-up with ‘QIA Quick PCR Purification Kit’ (QIAGEN Catalog No: 28104) or sequenced after generating clones (TA-cloned using the ‘ThermoFisher Scientific InsTAclone PCR Cloning Kit’ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All of the real-time PCR reactions were performed with RT2 SYBR Green/ROX PCR Master Mix (Cat# 330503, Qiagen, Valencia, CA, USA) and relative mRNA expression of each gene was determined using CFX96 real-time system (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Microsatellites were co-amplified in multiplex PCR (Table 2) with a Thermocycler T Gradient machine (Biometra, Goettingen, Germany) using the Qiagen® Multiplex PCR Kit (Qiagen, Hilden, Germany). Forward primers were 5’-labeled with fluorescent dyes HEX ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We verified the PCR products by 1% agarose electrophoresis with EtBr staining and purified using the QiaQuick PCR Purification Kit (Qiagen, Hilden, Germany, 28104) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5μl of diluted cDNA (1:3 - nuclease-free water) was used as template in 10μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad ...
-
bioRxiv - Physiology 2023Quote: ... and IFNγ mRNA was performed on the StepOne Plus Real Time PCR System instrument using the QuantiTect SYBR Green PCR Master Mix (Qiagen, Cat No: 204143). The primers are presented in the Supplemental Materials (Table S2) ...
-
bioRxiv - Neuroscience 2022Quote: PCR with forward and reverse primers (see Table 1) was performed on mouse hypothalamic cDNA (isolated with miRNeasy Mini Kit, Qiagen, Hilden, Germany). PCR products were ligated into pGEMT.easy (Promega ...
-
Role of autophagy in sepsis-induced skeletal muscle dysfunction, whole-body metabolism, and survivalbioRxiv - Cell Biology 2021Quote: ... Each primer (3.5 μl) was combined with reverse-transcriptase reagent (1 μl) and SYBR® Green master mix (25 μl) (Qiagen, Valencia, CA). The thermal profile was as follows ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... First strand cDNA was synthesized from 0.5 mg of total RNA using QIAGEN RT2 First Strand Kits and transcripts for mouse cytokines and chemokines were quantified using qPCR microarrays comprising 96-well plates precoated with primers (QIAGEN PAMM-150Z). Each 96-well plate also contained primers for 5 housekeeping genes as well as positive and negative controls ...
-
bioRxiv - Microbiology 2023Quote: The coding sequences of SiCHIT and SvCHIT were amplified using the primers listed in Supplementary Table S1 and cloned into an expression vector (pQE-80L, Qiagen, Hilden, Germany) using Gibson assembly (New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: The preparation of RNA for RT-qPCR experiments was performed according to the manufacturer’s instructions using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). Isolated RNA was transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... 0.08M KOH was added to each well and incubated at room temperature (RT) for 5 min and then washed with EB (Qiagen, 19086). Next ...
-
bioRxiv - Molecular Biology 2023Quote: Isolated RNA samples were reverse-transcribed into cDNA in 20 μl final reaction volumes using miScript II RT Kit(Qiagen,,Germany) as specified in the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was subsequently generated using 2 μg of total RNA and the miScript II Reverse Transcription (RT) Kit (Qiagen, Australia), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 500ng of RNA were used to perform reverse transcription using the miScript RT II Kit and HiFlex Buffer Reverse Transcription (Qiagen, Netherlands). Quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... and miRNAs from each HTM cells was reverse transcribed into cDNA using miScript II RT kit as per the manufacturer’s instruction (Qiagen, Hilden, Germany). RT-qPCR was performed in a total volume of 20 µl containing 25 ng of total cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The preparation of RNA for RT-qPCR experiments was performed according to the manufacturer’s instructions using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). Isolated RNA was transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 ng of total RNA was used for first strand cDNA synthesis using miRCURY LNA RT Kit (QIAGEN, Cat. No. 339340). Quantification of the relative miRNAs’ expression level was detected by specific miRCURY LNA miRNA PCR Assays and highly sensitive miRCURY LNA SYBR® Green PCR Kit while adjusting the reverse transcriptase product dilution to 1:30 (QIAGEN ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA purification and cDNA synthesis were performed using the AdnaTest Prostate Cancer Detect and the Sensiscript RT Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... all samples were diluted to the same RNA concentration and 250 ng of RNA from each sample spiked with 100 ng mouse RNA to control reaction efficiency were reverse transcribed using the miScript II RT kit (Qiagen, 218161) with HiFlex Buffer according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... 5 μl of each sample was pooled into one of 5 indexed libraries and PCR purified using a QIAquick PCR Purification Kit (Qiagen, Inc., Valencia, CA, USA). Prior to preparing individuals for next generation sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed twice with the blocking buffer and incubated at 4 °C with primary antibodies (mouse anti-Strep, Qiagen, Cat #: 34850, 1: 150 dilution) (rabbit anti-PDI ...
-
bioRxiv - Microbiology 2020Quote: ... The product was purified by the PCR purification kit (Qiagen) and cut by XbaI and HindIII (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and miRCURY LNA miRNA PCR Assays (Qiagen Cat. No. 339306). Mir-103 (Qiagen primer Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was purified using the QIAquick PCR purification kit (Qiagen) and subjected to qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... Fold enrichment was quantified using qRT-PCR (SYBR Green; Qiagen) and calculated as a percentage of input chromatin (% Inp) ...
-
bioRxiv - Cell Biology 2020Quote: ... and a Rotor-Gene Q Rea-time PCR cycler (Qiagen). Data was analyzed using the comparative CT method (Livak and Schmittgen ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification using the QIAquick PCR Purification Kit (Qiagen, 28104), 1μg of this material was then ligated in a volume of 20 μl with 1 μl of T4 DNA ligase (Roche ...