Labshake search
Citations for Qiagen :
301 - 350 of 948 citations for Zika Virus Lysate PRVABC59 strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... After the lysate was homogenized using the QIAshredder Kit (Qiagen; 79656), mRNA was extracted using the RNeasy Plus Micro Kit and eluted in 30μL of RNAse-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and lysate was passed over 8 mL Ni-NTA resin (Qiagen) using gravity chromatography ...
-
bioRxiv - Systems Biology 2022Quote: ... Cell lysates were processed using the Allprep DNA/RNA kit (Qiagen). The protein containing flow-through (500µl ...
-
bioRxiv - Neuroscience 2023Quote: ... the lysate was processed using total RNeasy mini kit (Qiagen, Germany). The lysate was resuspended in a 1:1 volume of 70% ethanol and loaded onto an extraction column and centrifuged (8000g for 2 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysate-ethanol mix was then purified using RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and clarified lysate was incubated with Ni-NTA affinity resin (Qiagen) for 1 h ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The clarified lysate was incubated with Ni-NTA agarose beads (Qiagen) for 1.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Protein was purified from sonicated lysates using Ni-NTA resin (Qiagen) and gravity flow ...
-
bioRxiv - Cell Biology 2023Quote: ... and clarified lysate was loaded into Ni-NTA Agarose (Qiagen, USA) gravity column pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... The clarified cell lysate was then incubated with NiNTA resin (Qiagen) pre-equilibrated in Buffer A for one hour ...
-
bioRxiv - Genetics 2023Quote: ... Cell lysates were homogenized using QIAshredder spin columns (Qiagen, Cat #79656) and genomic DNA was removed by an on-column DNase treatment (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Lysates were thawed on ice and the remaining steps from Qiagen kit were carried out at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... Clarified bacterial lysate was then incubated with Ni-NTA agarose (Qiagen) at 4 °C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were then homogenized by passing them through QIAshredder cartridges (Qiagen). Proteins were precipitated by adding an equal volume of ice cold 55% Trichloroacetic acid (TCA ...
-
bioRxiv - Biophysics 2023Quote: ... The cleared lysate was loaded onto tandem Streptactin XP columns (QIAGEN), equilibrated in Buffer A ...
-
bioRxiv - Physiology 2023Quote: ... The tissue lysates were treated with 1% DNase (Qiagen, Hilden, Germany) and diluted to a protein concentration of 10μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... The lysate was applied to the Ni-NTA agarose resin (Qiagen) and the resin was washed three times using a buffer [20 mM Tris-HCl (pH 8) ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was then purified with Ni-NTA resin (Qiagen) in batch mode ...
-
bioRxiv - Microbiology 2024Quote: ... Cleared lysate was bound to Strep-Tactin Superflow Plus resin (Qiagen). The resin was washed first with lysis buffer and then with RNP buffer (20 mM HEPES-KOH pH 7.9 ...
-
bioRxiv - Physiology 2023Quote: ... Tissue lysates were further clarified by microcentrifuge spin columns (QIAshredder, Qiagen) to obtain clear protein lysate centrifuged at 10,000g for 2min at 41C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clarified lysate was incubated with 0.5 mL NiNTA resin (QIAGEN) for 1 hr at 4°C on a rotary ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... urticae DNA was extracted from the WT strain using the Gentra Puregene Tissue Kit (QIAgen), according to the manufacturer’s instructions and using 100 adult females as starting material ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CH-ME49 cysts and RH strain tachyzoites using the DNeasy Blood % Tissue Purification Kit (Qiagen). The cytochrome b coding sequences were amplified from genomic DNA and cDNA by PCR with primers 5’ATGGTTTCGAGAACACTCAGT ...
-
bioRxiv - Microbiology 2020Quote: ... coli C600 strain using an Endofree Maxi-Prep kit from Qiagen (QIAGEN, catalog number 12362) following the manufacturer’s recommendations.
-
bioRxiv - Genomics 2021Quote: ... castellanii strains Neff and C3 using the QIAGEN Blood and Cell Culture DNA Kit (Qiagen) following the specific recommendations detailed by Oxford Nanopore Technologies in the info sheet entitled “High molecular weight gDNA extraction from cell lines (2018)” in order to minimize DNA fragmentation by mechanical constraints ...
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... crassa strain 87-3 (bd+, mat a) using the Gentra Puregene Tissue kit (Qiagen, 158622) and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Typhimurium strain were (n = 3) were extracted using the Rneasy kit (Qiagen Sciences, Maryland, USA), after an overnight culture in CBD tinted LB broth (for CBD-resistant strain ...
-
bioRxiv - Genomics 2023Quote: ... succinogenes strain UWB7 monoculture & co-culture pellets using the RNeasy Mini Kit (Qiagen, Germantown, MD) following the protocol for purification of total RNA from plant cells and tissues and filamentous fungi ...
-
bioRxiv - Microbiology 2023Quote: ... cholerae ΔSI strain (A101) was extracted using the DNeasy® Blood and Tissue Kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: Genomic DNAs were purified from strains CZ26710 and CZ26711 using Gentra Puregene Tissue Kit (Qiagen). Whole genome DNA library preparation and 90 bp paired-end sequencing was performed by Beijing Genomics Institute (BGI ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acids were extracted using QIAamp 96 virus Qiacube HT kit on QIAxtractor Automated extraction (Qiagen, US) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: The virus RNA was extracted from clinical samples using the QIAamp viral RNA mini kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: Viral RNA from cell culture supernatants was isolated as the manufacturer’s instructions using QIAamp MinElute Virus kit (Qiagen). Cells were suspended in TRI Reagent (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: Load Viral RNA was isolated from plasma and cerebral spinal fluid (CSF) using the QuantiTech Virus Kit (Qiagen). Viral loads were quantified by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was extracted from 200 µl of the inactivated supernatant using the EZ1 Virus Mini Kit (Qiagen, Germany). As described previously ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from nasopharyngeal swab samples on the QiaSymphony platform using the Virus Pathogen Mini Kit (Qiagen). Libraries were prepared using the Illumina DNA Flex library preparation kit and sequenced on an Illumina MiSeq (V2 ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was extracted from 140 µl of virus stock (SARS-CoV-2 VOC Delta, GISAID ID: EPI_ISL_15250227) using a QIAamp Viral RNA Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: RNA from virus stocks was extracted with the QIAamp Viral RNA Mini Kit (Cat# 52904, QIAGEN, Hilden, Germany), and one-step cDNA synthesis was then performed with SuperScript IV RT Viral cDNA (Cat# 12594025 ...
-
bioRxiv - Immunology 2022Quote: ... 200 μL of nasal swab sample was extracted with the QIAamp 96 Virus QIAcube HT kit (Qiagen, Germany) on the QIAcube HT System (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was extracted from the virus stocks using the QIAamp viral RNA mini kit (Qiagen, Cat#74l36) and viral genomes were sequenced as described before [31].
-
bioRxiv - Microbiology 2023Quote: Virus isolates and respiratory specimens were extracted using the QIAgen Viral RNA Mini-Kit (QIAgen, Inc., Valencia, CA). Input sample volume was 140 μl ...
-
bioRxiv - Biophysics 2020Quote: ... Cells lysates were treated with 100 μg/mL of RNase A (Qiagen). Lysates were cleared by centrifugation and then incubated with Glutathione-Sepharose 4B resin (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cleared lysates were then passed through a Ni-NTA column (Qiagen 30250) that was equilibrated with P5 Buffer pH 7 (20 mM NaHPO4 ...
-
bioRxiv - Cell Biology 2019Quote: ... the lysates were collected and incubate with Ni-NTA agarose beads (QIAGEN) for 4 hr ...
-
bioRxiv - Cell Biology 2019Quote: ... The cleared lysate was batch bound to Ni-NTA agarose beads (Qiagen) for 1 h at 4oC ...
-
bioRxiv - Developmental Biology 2021Quote: ... before the lysate was recovered and passed through a QIA shredder (Qiagen). An equal volume of 100 % ethanol was added to the homogenised lysate before being transferred to a RNeasy extraction column ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were loaded onto a 5 mL Ni-NTA Superflow Cartridges (Qiagen) equilibrated with Buffer B (25 mM HEPES ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was incubated with Ni-nitrilotriacetic acid (NTA) resin from Qiagen for 1hr at RT ...