Labshake search
Citations for Qiagen :
301 - 350 of 10000+ citations for Two Hybrid System Construction kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Treatment was repeated on the next two days and total RNA was extracted the following day with the QIAzol lysis reagent (Qiagen). The corresponding cDNAs were prepared by reverse transcription of 1 μg of RNA using the SuperScript III First-Strand Synthesis System (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... Frozen spores were lysed using cryogenic bead beating with two 5 mm steel beads shaking twice for 45 sec at 25 Hz using TissueLyser II (Qiagen). Lysis buffer was added to the frozen broken spore pellet ...
-
bioRxiv - Genetics 2021Quote: ... were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution) in the PyroMark Q24 (Qiagen). The peak height from dispensation 13 (T ...
-
bioRxiv - Genomics 2022Quote: ... the genomic DNA of the Nichi01 strain was isolated from the silk glands of two male fifth-instar larvae using Genomic-tips 100/g and Genomic DNA Buffer Set (QIAGEN). Long-read sequencing for genome assembly was performed using continuous long-read (CLR ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-PCR reactions for each primer set were performed on RNA (50-75 ng/ul) from at least two biological replicates of the mutant allele and control (QIAGEN OneStep RT-PCR Kit ...
-
bioRxiv - Microbiology 2023Quote: ... fresh 0.35 g/L proteinase K) during two rounds of 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Total RNA was converted into complementary DNA (cDNA ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Biochemistry 2023Quote: ... The two lysates were then combined and cleared by centrifugation prior to application onto a Ni-NTA Agarose column (Qiagen) equilibrated in buffer L lacking protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2023Quote: ... calf muscle and pancreas were collected in 500 μl of PBS containing one (heart and pancreas) or two (calf muscle) 5 mm stainless steel beads (QIAGEN), homogenized with TissueLyser II (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... circularized DNA was purified with AMPure XP beads and 4C-libraries were finally generated by two rounds of PCR and purified by QIAGEN column ...
-
bioRxiv - Molecular Biology 2023Quote: ... The BmAgo3 immunoprecipitated beads were divided into two and incubated in buffer D with/without 200 μg/ml RNase A (Qiagen) at 30°C for 15 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µL from the supernatant and cell lysates were applied on a nylon membrane and two different antibodies (an HRP-conjugated anti-His tag from Qiagen and an HRP-conjugated anti-strep tag from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... mosquitoes were homogenized in 500 μl ice-cold 1X Phosphate Buffered Saline buffer with two ice-cold steel bearing balls (3 mm diameter, LOUDET) using a TissueLyser II (Qiagen) and clarified through centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Parasite DNA was extracted from 200 ul from EDTA whole blood using EZ1 DNA blood kit with automated EZ1 Advanced XL purification system (Qiagen, Hilden, Germany). Real Time PCR for P ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was isolated from the GCL tissue by the “cut and LPC” method using a PALM Zeiss UV laser capture microdissection system and an RNeasy kit (Qiagen, Valencia, CA), and a portion (1 ng ...
-
bioRxiv - Microbiology 2021Quote: ... This was then purified using the automated DNA purification protocol with DNeasy PowerWater Kit on a QIACube system (QIAGEN, Cat. no. 9001292). In addition to the samples ...
-
bioRxiv - Microbiology 2021Quote: ... Resultant cDNAs were used as template for qPCR and qPCR was performed on an Applied Biosystems 7900HT Sequence Detection system using a Sybr Green Quantitect kit (QIAGEN, Hildesheim, Germany). Quantification cycle (Cq ...
-
bioRxiv - Developmental Biology 2023Quote: ... stagnalis postmetamorphic snails (st. 28-29) and adult nervous systems were utilized for total RNA isolation using the RNeasy Mini Kit (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... 3D05 were performed in a duplex dPCR reaction using the QIAcuity Probe PCR kit and the QIAcuity Digital PCR system (QIAGEN; Hilden, Germany). Concentrations and thermocycling conditions were performed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Cell-free DNA was isolated with the QIAsymphony SP DNA Preparation System and the QIAsymphony DSP Circulating DNA Kit (Qiagen, Hilden, Germany) according to the manufacturer’s advice ...
-
bioRxiv - Immunology 2019Quote: ... in a TissueLyser system (Qiagen). cDNA was generated as described above and gene expression was measured in a LightCycler480 II using the Universal Probe Library system (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... using a QIAcuity system (QIAGEN). For the reactions ...
-
bioRxiv - Biochemistry 2023Quote: ... using a QIAcuity system (QIAGEN). A QIAcuity EvaGreen (EG ...
-
bioRxiv - Genomics 2020Quote: ... and from two “normal” males (50289,70203) and one “normal” female (20025) were collected and stored in RNAlater™ (QIAGEN, Hilden, Germany). The normal individuals may be carriers of the genetic variant(s ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Microbiology 2021Quote: Cell pellets from 6 mL samples collected at T1-T4 during growth of two biological replicates of the original XG-degrading culture were supplemented with RNAprotect Bacteria Reagent (Qiagen, USA) following the manufacturer’s instructions and kept at −80 °C until RNA extraction ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatant was divided into two parts: one part was directly combined with nickel-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen, China); the other part was heated in a 65 °C water bath for 60 minutes and then centrifuged at 14000 rpm for 60 minutes ...
-
Revisiting a GWAS peak in Arabidopsis thaliana reveals possible confounding by genetic heterogeneitybioRxiv - Genetics 2021Quote: ... Tissue was disrupted by adding two small stainless beads bearings and agitating with a tissue lyser (tissuelyser II, Qiagen, Hilden, Germany) for 10 min at 20 rev/s ...
-
bioRxiv - Genetics 2020Quote: ... we split the 50 μl reaction volume into two and we added 25 μl of guanidine hydrochloride (Buffer PB, Qiagen 28606) to each as a chaotropic agent to stop the reaction and dissociate the proteins and transposase from the DNA ...
-
bioRxiv - Biochemistry 2021Quote: Purified CrFBA3 was tested for crystallization at two concentration of 9 mg/ml and 4.5 mg/ml on commercial sparse-screening conditions (Qiagen, Hilden Germany) based on the work of Jancarik and Kim (Jancarik ...
-
bioRxiv - Microbiology 2023Quote: ... two negative PCR controls (further termed as no PCR template controls, NTCs; RNA free water; Cat. No. 760011596, Qiagen, Hilden, Germany) were used ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with the addition of reservoirs for larger sample volumes12 followed by two rounds of elution with 30 μl elution buffer (Qiagen EB). Extracts were stored at -20°C until library preparation and sequencing at the Genomics Facility of the University of Manchester for data acquisition.
-
bioRxiv - Evolutionary Biology 2023Quote: ... was added to each sample tube and homogenization was conducted with two shaking steps at 25 Hz for 2 min by TissueLyser (Qiagen, USA). RNA extraction was performed with the Direct-zol RNA MicroPrep Plus kit (Zymo Research ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in 384 well plates on an Applied Biosystems 7900HT Fast Real-Time PCR system using the QuantiTect Virus Kit (Qiagen, Redwood City, CA) and SARS-CoV-CDC RUO primers and probes (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Immunology 2022Quote: ... two rounds of nested PCR reactions were carried out using the cDNAs as template and Hot Start DNA Polymerases (Qiagen, Thermo Fisher) and specific primer sets described previously 86 ...
-
bioRxiv - Genetics 2019Quote: ... blood samples were extracted from the caudal vein of two normal diet fed and two low-fat diet fed 2212 °d fry from Lammi Biological Station and stored in RNAprotect Animal Blood Tubes (Qiagen, Hilden, Germany) at −20 °C ...
-
bioRxiv - Microbiology 2019Quote: ... we performed PCR on DNA from two leaf epiphyte samples (sample IDs: 108A and 109A) using Taq DNA Polymerase (QIAGEN, Hilden, Germany) with the following conditions ...
-
bioRxiv - Genomics 2020Quote: ... Additional biopsy sections were collected from the same regions and at two distinct areas of the tumor were placed in Allprotect Tissue Reagent (Qiagen, Hilden, Germany) and stored at 4° C for DNA extraction and evaluated histopathologically ...
-
bioRxiv - Plant Biology 2020Quote: Tocochromanols in 50.3 ± 0.4 mg DW of ground seed powder were extracted in 750 μL of icecold heptane, using two 3-mm diameter glass beads (Carl Roth GmbH+Co, Karlsruhe, Germany) and a Tissue-Lyser (Qiagen, Hilden, Germany) at 25 Hz for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... 100 μL 0.1mm glass beads were added into the filter casing and put through two 10-minutes cycles of bead beating in a Tissuelyser (Qiagen, Hilden, Germany). The flow-through ...
-
bioRxiv - Microbiology 2020Quote: ... 120 mg l-1 sodium pyruvate and 10% FCS (supplemented with 10% Fetal Calf Serum and 1% penicillin–streptomycin) at 300 Hz for two minutes using the Tissuelyser II (Qiagen, Hilden, Germany) and centrifuged to clarify the supernatant ...
-
bioRxiv - Bioengineering 2019Quote: ... The cut membranes were sandwiched between two O-rings and placed into a commercial miniprep spin column (Figure S2) (Qiagen, Hilden, Germany). The spin column was then placed into a clear 2 mL collection tube.
-
bioRxiv - Microbiology 2021Quote: ... Maize and soybean leaf and root tissue were pulverized for 2-min at a speed of 30 Hz with two 4-mm stainless balls in a TissueLyser II (Qiagen, Venlo, Netherlands). Total DNA was extracted from plant tissues with the OMEGA Mag-Bind Plant DNA Plus kit (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2020Quote: Ticks were homogenised in a 2 ml reaction tube with two 5 mm steel beads and 500 μl PBS using a Tissue Lyser II (Qiagen, Hilden, Germany) for 3 min at 30 Hz ...
-
bioRxiv - Immunology 2020Quote: ... and light (Vκ and Vλ) genes were amplified separately from the pooled cDNA samples by two rounds of PCR using HotStarTaq (Qiagen, Cat# 203443) and human antibody sequences primers derived from previous report15 ...
-
bioRxiv - Neuroscience 2022Quote: Homogenization was performed at 200 oscillations/min for two minutes using a QIAGEN TissueLyser II bead mill (QIAGEN Inc.-USA, Germantown, MD). 13C6 glucosylsphingosine and d5 glucosylceramide d18:1/18:0 (Avanti ...
-
bioRxiv - Microbiology 2022Quote: ... The Eppendorf tubes were then placed two times for 1 min at 30 Hz in a TissueLyser (Qiagen Inc., Germantown, MD, USA) to disrupt wood tissues ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the Qiacube automated system (Qiagen). Quality control for total RNA was performed using TapeStation (Agilent) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... using the Qiacube automated system (Qiagen). RNAseq libraries (cat no ...