Labshake search
Citations for Qiagen :
301 - 350 of 2580 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Chondrocytes were transfected in duplo with antisense locked nucleic acid (LNA) GapmeR (Qiagen) targeting P3H2-AS1 (TGAGCAACTAGGTGTA ...
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Cancer Biology 2023Quote: ... all proteins were purified using Ni-NTA (nickel-nitrilotriacetic acid) resin from QIAGEN. After the incubation of Expi293 media supernatant with the Ni-NTA resin ...
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were first purified using nickel-nitrilotriacetic acid (NTA) agarose resin (Qiagen), and the His8-SUMO tag was then removed by TEV protease (10:1 w/w ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial nucleic acid was extracted using the EZ1 DNA tissue kit (Qiagen, Germany) on EZ1 Advanced XL (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) on a rocker for 1 hour at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... resuspended in 500 µL ribonucleic acid (RNA) protect bacterial reagent (Qiagen, Cat. # 76506), allowed to incubate at room temperature for 10 minutes followed by centrifugation at 5,000 x g for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... nucleic acid was extracted from cells or tissues using DNeasy mini kit (Qiagen). HIV-1 DNA was quantified by real-time PCR ...
-
bioRxiv - Cancer Biology 2024Quote: Locked nucleic acid GapmeR antisense oligonucleotides (LNA ASOs) targeting LINC01432 (Qiagen, cat# 3653410) and CELF2 (Qiagen ...
-
bioRxiv - Biophysics 2024Quote: ... Affinity purification was performed using nickel nitriloacetic acid (Ni-NTA) affinity column (Qiagen) attached to an AKTA™ start system (Cytiva) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Genetics 2024Quote: ... 4 µL RNase (QIAGEN, Venlo, The Netherlands) was added ...
-
bioRxiv - Immunology 2024Quote: ... containing 4 IU/ul DNAseI (Qiagen, 79254) and 1 IU/ul RNAseq inhibitor (Recombinant RNAsin ...
-
bioRxiv - Cell Biology 2024Quote: ... with 4 µg/mL DNase (79254, Qiagen) at 37 °C for 15-20 min ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Developmental Biology 2020Quote: ... and the soluble homogenates were purified by Ni-nitrilotriacetic acid (NI-NTA) Agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids were extracted from frozen faecal aliquots using the RNeasy PowerMicrobiome kit (Qiagen). The manufacturer’s protocol was modified by the addition of a heating step at 90°C for 10min after vortexing and by the exclusion of DNA-removal steps ...
-
bioRxiv - Systems Biology 2021Quote: ... The supernatant was loaded on a nickel nitrilotriacetic acid (Ni-NTA) resin (Qiagen GmbH) column ...
-
bioRxiv - Cell Biology 2021Quote: ... We purified the 6xHIS fusion protein on nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, CA) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleic acids were extracted with the Qiagen Power Fecal Pro kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
Heterologous expression of Dehalobacter spp. respiratory reductive dehalogenases in Escherichia colibioRxiv - Microbiology 2021Quote: ... and nickel-nitrilotriacetic acid (Ni-NTA) agarose resin was purchased from Qiagen (Hilden, Germany). PCR reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nucleic acids were subsequently extracted using the AllPrep DNA/RNA Mini Kit (QIAGEN, #80204) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... The enzyme was purified through a nickel-nitrilotriacetic acid column (Ni-NTA superflow, Qiagen), which was followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1.2 µM custom template-switching oligo with a Locked Nucleic Acid analog (Qiagen) at 42°C for 90 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid locations were confirmed through sequence alignment using MacVector and CLC Workbench (QIAGEN).
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Microbiology 2022Quote: Total nucleic acids were extracted in duplicate using the PowerSoil-Kit (MO-BIO, Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... S1 RBD was purified from the culture supernatant by nickel–nitrilotriacetic acid agarose (Qiagen), and purity was confirmed to by >95% as judged by coomassie stained SDS-PAGE ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... coli Rosetta cells was carried out using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) as described in Barja and Rodríguez-Concepción (2020) ...
-
bioRxiv - Molecular Biology 2021Quote: ... we added 70 µl of Ni-NTA (Nickel Nitrilo-triacetic Acid) agarose beads (Qiagen), and incubated the mixture overnight at the orbital rotator at RT ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 ml of culture supernatant was incubated with nickel-nitrilotriacetic acid-agarose beads (QIAGEN). The beads were washed ...
-
bioRxiv - Molecular Biology 2023Quote: ... After purification of AtH2B.9 using nickel-nitrilotriacetic acid agarose (Ni-NTA) resin (QIAGEN), the His6-tag portion was removed by TEV protease (30 µg/mg of His6-H2B.9) ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acid extraction was carried out using DNeasy PowerSoil Pro Kit (QIAGEN, Hilden, Germnay) following manufacturer instructions ...
-
bioRxiv - Immunology 2024Quote: ... Proteins were purified from filtered supernatants using nickel nitriloacetic acid (Ni-NTA) agarose (QIAGEN) via gravity flow ...
-
bioRxiv - Developmental Biology 2023Quote: ... specific locked nucleic acid (LNA) probes doubly-labelled with digoxigenin were purchased from Qiagen and ISH was conducted following the published protocol (Chen et al. ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... Soluble RBD was purified under denaturing conditions using a nitrilotriacetic acid-Ni2+ column (Qiagen)[19] ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatant was loaded onto a nickel-nitriloacetic acid (Ni2+-NTA) column (Qiagen, Hilden, Germany), washed with 500ml buffer A ...
-
bioRxiv - Biophysics 2022Quote: The obtained supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) in a rotating shaker for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The clarified lysate was incubated with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (Qiagen) for 1 hour with agitation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the clarified lysate was loaded on a Ni-nitrilotriacetic acid (NTA) agarose column (Qiagen) using the ÄKTA Explorer fast protein liquid chromatography system (FPLC ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA is isolated using the column based nucleic acid purification kit (RNeasy, Qiagen), strictly according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... the supernatant was incubated with 3 ml nickel- nitrilotriacetic acid Ni-NTA beads (Qiagen) preequilibrated with the same buffer overnight ...
-
bioRxiv - Microbiology 2024Quote: ... Lysates were subjected to pull down using nickel-nitrilotriacetic acid (Ni-NTA) beads (Qiagen) overnight at 4 °C on a rotation platform ...
-
bioRxiv - Neuroscience 2024Quote: ... for GST-tagged CMK-1 variants or nickel-nitrilotriacetic acid beads (Ni-NTA, Qiagen) in the presence of 15 mM imidazole for TAX-6-His6 protein binding ...