Labshake search
Citations for Qiagen :
101 - 150 of 2580 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Locked nucleic acid (LNA) probes (Qiagen) to detect either sense (5’ TYE563-labelled CCCCGGCCCCGGCCCC ...
-
bioRxiv - Immunology 2024Quote: ... RNA extraction was performed by QIAGEN Nucleic Acid Isolation Service (QIAGEN, Germany). RNA integrity number (RIN ...
-
bioRxiv - Physiology 2024Quote: RNA was collected from the cells without H/R and after H/R stress with the RNEasy kit (Qiagen) the RNA quality and quantity was evaluated using a μLITE analyzer (BioDrop ...
-
bioRxiv - Cell Biology 2020Quote: ... Circulating cell-free nucleic acid (ccfNA) was extracted using the Qiamp Circulating Nucleic Acid kit (Qiagen, USA) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Nasal turbinates and lungs were collected from a subset of hamsters at 4 dpi and homogenized in 1ml or 5 ml of PBS with TissueRuptor (Qiagen), respectively ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from the stomach and pyloric caeca tissue samples stored at -80 °C (n = 4 for control and fly larvae, n = 5 for shrimp shell) using the RNeasy Plus Universal Kit (QIAGEN). RNA quality was assessed using a 2100 Bioanalyzer with the RNA 6000 nano kit (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... and adult females (approximately 4-5 of each) were prepared for RNAseq using the RNeasy Blood and Tissue Kit (Qiagen). Individuals were placed in a 1.5 mL safelock tube along with 5-8 one mm glass beads placed in liquid nitrogen and then shaken for 30 s in a Silamat S6 shaker (Ivoclar Vivadent) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were pelleted at 350 x g for 5 min at 4 °C and lysed in 350 μl RLT buffer of the RNeasy Mini Kit (Qiagen). RNA was isolated according to the manufacturer’s instructions ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Lysates were cleared by centrifugation at 15000 x g for 30 min at 4 °C and incubated in Pierce 5 ml columns with Ni-NTA agarose beads (Qiagen) at 4 °C for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: mRNA was isolated from Boyden chamber migration assay-derived Treg pellets from 5 HD and 4 uRRMS patients using RNeasy micro kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Genomics 2024Quote: ... The pooled cells were centrifuged at 500 × g for 5 minutes at 4°C and resuspended in 100 μl of buffer EB (Qiagen).
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Those included UniSpike 2 and 4 from the QIAGEN RNA Spike-In Kit (Cat. No.: 339390, QIAGEN, Hilden, Germany), which were used to monitor RNA isolation efficacy ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng psiCHECK-2 reporter plasmid were co-transfected with 5 µl miScript miRNA mimics (Qiagen; CatNo. 219600) using 4 µl Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) was used to purify the protein via gravity flow and proteins were eluted as previously described37,38 ...
-
bioRxiv - Microbiology 2021Quote: ... and associated nucleic acid extraction (Qiagen, Germany) kits were used ...
-
bioRxiv - Genomics 2024Quote: ... and QIAamp Circulating Nucleic Acid Kit (Qiagen) for EAC samples ...
-
bioRxiv - Microbiology 2024Quote: ... Ni-nitrilotriacetic acid (NTA) beads (Qiagen, USA) were used to purify the protein ...
-
bioRxiv - Pathology 2024Quote: ... the Circulating Nucleic Acid Kit (Qiagen, 55114) was employed with specific modifications to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng of plasmid DNA was transfected into each well using Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427). Unless otherwise noted ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of plasmid DNA was transfected into each well using Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427). Unless otherwise noted ...
-
bioRxiv - Genomics 2023Quote: ... 50 nuclei were sorted into each well of 4 twin.tec™ 96 Well LoBind PCR Plates that had 5 uL of EB buffer (Qiagen, 19086), 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: A total of 600 μL (three × 200 μL) of day 4 SARS-CoV-2 culture supernatant was used as input into the RNeasy Mini Kit (Qiagen) for RNA extraction with minor modifications ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Lysates were clarified by centrifugation at 24,000gat 4 °C for 20 min and passed through 2 ml of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was then cleared by centrifugation at 42,000 ξ g for 50 min at 4°C before being applied to 2 mL of Ni-NTA resin (QIAGEN) in a gravity flow column ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of cDNA was then added to a PCR mix containing 12.5 μl 2× Multiplex PCR mix (Qiagen), 9 μl H2O ...
-
bioRxiv - Genomics 2023Quote: MII oocytes and 2-cell embryos were individually lysed and flash-frozen in 5 μl RLT Plus buffer (Qiagen) and stored at −80°C until further use ...
-
bioRxiv - Physiology 2024Quote: Frozen tissue was transferred into pre-chilled 2 ml microfuge tubes containing two 5 mm stainless steel beads (Qiagen) and 5 volumes of ice-cold buffer (10 mM HEPES buffer pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene of interest (GOI) siRNA or control siRNA were incubated at room temperature with Enhancer R and Buffer EC-R (Qiagen, USA) for 20 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Genetics 2020Quote: ... DNA binding plate was incubated with 600 μL of liquid for 4 minutes at RT and centrifuged at 1,300 g for 5 minutes sequentially with PB buffer (Qiagen Cat. No. 19066), followed by PE buffer (Qiagen Cat ...
-
bioRxiv - Biophysics 2020Quote: ... The lysate was cleared by centrifugation at 18000 rpm at 4°C and the supernatant was loaded onto 5 mL Ni–NTA resin (Qiagen, Milan, Italy) equilibrated with binding buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...