Labshake search
Citations for Qiagen :
301 - 350 of 958 citations for IL 4 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Neuroscience 2021Quote: Mouse posterior cortex was disrupted for RNA isolation using the TissueLyser (QIAGEN, Hilden, Germany) for 2 x 2 min at 20 Hz as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: Purified RNA was isolated from mouse skin using the RNeasy Plus Mini Kit (Qiagen) after pulverization of the frozen skin tissue and homogenization with the QIAshredder system (Qiagen) ...
-
bioRxiv - Biochemistry 2019Quote: Fecal DNA from mouse colon was extracted by QIAamp PowerFecal DNA Kit (Qiagen, Germany) with minor modifications ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from mouse hippocampal samples using a RNeasy Mini kit (Qiagen), following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... and from mouse tissue (liver, retina, RPE) using a DNeasy Blood & Tissue kit (Qiagen). Target sequences were PCR-amplified using 2X Taq PCR Smart mix (SolGent) ...
-
bioRxiv - Physiology 2020Quote: Whole RNA was extracted from mouse orbital fat samples using RNeasy mini-kits (Qiagen). cDNA was prepared using Superscript III first-strand synthesis kit (ThermoFisher) ...
-
bioRxiv - Pathology 2022Quote: Total RNAs were obtained from cells or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... Viral RNA was subsequently isolated from mouse plasma using the MinElute Virus Kit (Qiagen) on the QiaCube ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR was then performed with specific primers for mouse IFN-α11 (PPM03050B-200, Qiagen), mouse β-actin (PPM02945B-200 ...
-
bioRxiv - Systems Biology 2022Quote: ... DNA was isolated from mouse tissues using the DNeasy Blood and Tissue Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA from mouse lungs was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2019Quote: Total RNA (100–200 islets/mouse) was extracted using the RNeasy Mini Kit (Qiagen). RNA quality and quantity was measured on the Agilent 2200 TapeStation System ...
-
bioRxiv - Molecular Biology 2020Quote: Total mouse heart RNA was isolated with an RNeasy mini kit (Qiagen, Valencia, CA) or RNAqueous® Micro RNA isolation kit (Ambion ...
-
bioRxiv - Immunology 2019Quote: ... RT2 Profiler™ PCR Array Mouse Autophagy was purchased from Qiagen (Catalog # PAMM-084Z). RNA extracted from the brain of pups born to infected dams were analyzed for the expression of autophagy-related genes following the manufacturer’s instruction and as previously described (13).
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from mouse MLL-AF9 cells by RNeasy Micro Kit (Qiagen), 72 hours after transduction of the cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... for mouse samples and cell lines or with miRNeasy Mini Kit (Qiagen, Hilden, Germany) for human tissue samples ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA was isolated from lentiviral injected mouse brains using the DNeasy kit from Qiagen according to the manufactures protocol with the help of a tissue grinder (Dixon Science) ...
-
bioRxiv - Neuroscience 2023Quote: RNA from whole mouse OE samples was extracted using RNeasy kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA from brain organoids and mouse tissue was extracted with RNeasy Mini Kit (Qiagen) for mRNA detection ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA from mouse blood was extracted using a DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted from cells and mouse tumors using the miRNeasy kit (Qiagen, #217004) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... L1-L5 mouse DRG was homogenized with an RNeasy Mini Kit (Qiagen, Valencia, CA) using on-column DNase-I digestion according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... spongiae DNA was extracted from mouse tissues using DNAeasy Blood and Tissue kit (Qiagen). The numbers of mice used in each individual experiment were calculated to permit detection of at least a two- to four-fold difference in bacterial loads between groups with 95% (two-sided ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted from mouse islets using the RNAeasy Micro Kit (QIAGEN, Cat # 74004); RNA was extracted from flash-frozen liver and peripancreatic fat tissues using TRIzolTM (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: Mouse cDNA was amplified with gene-specific primers and HotStarTaq Master Mix Kit (Qiagen) (Table 1) ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was purified from mouse tissues using the RNeasy Plus Mini Kit (Qiagen) and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: Mouse kidney outer cortex tissues were dissected and homogenized in QIAzol (QIAGEN, Germantown, MD). Total RNA samples were extracted using RNeasy Plus Universal Kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Four 2-mL aliquots of culture were thoroughly mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) and incubated at room temperature for 5 min before centrifugation at 4,000 × g for 12 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed 4 times with 1 ml of IP buffer and 700 μl of Qiazol (Qiagen) was directly added to the beads ...
-
bioRxiv - Physiology 2020Quote: ... DNA was isolated using Qiagen MagAttract PowerMicrobiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) on the EpMotion 5075 (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Microbiology 2020Quote: ... The soluble fraction was incubated for 1 hour at 4 °C using a Ni-NTA resin (Qiagen). The Ni-NTA resin was washed with 4 times resin volume (RV ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from 4 mg of ground lyophilized material using the RNeasy Midi kit (Qiagen). A DNase treatment (Ambion ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated for ~2 h rotating at 4°C with Ni-NTA Resin (Qiagen, 1018244) that had been washed with wash buffer (20mM Tris HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2022Quote: Cell pellets or pieces of xenografts were lysed in 4% SDS buffer using a QIAshredder (Qiagen, 79654). See Supplementary Table S1 for antibodies used ...