Labshake search
Citations for Qiagen :
301 - 350 of 10000+ citations for Human Mitochondrial Open Reading Frame Of The 12S rRNA c MOTS c CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The cDNA library was amplified using a second set of multiple internally nested V-region and C-region primers with HotStarTaq DNA polymerase kit (Qiagen). The final PCR reaction was performed on an aliquot of the second reaction using a primer containing common base sequence and a third internally nested Cý primer ...
-
bioRxiv - Microbiology 2024Quote: ... 140 μL virus supernatant was treated with 0.25 μg RNaseA for 30 min in 37 °C to remove the extracellular RNA and continued with viral RNA extraction (QIAamp Viral RNA Kits, Qiagen) following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... 140 μL virus supernatant was treated with 0.25 μg RNaseA for 30 min in 37 °C and continued with viral RNA extraction (QIAamp Viral RNA Kits, Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Fecal pellets were collected and stored at −80°C until DNA extraction with DNeasy PowerLyzer PowerSoil Kit (Qiagen; 12855-100). Fecal Rg abundance was determined with Rg-specific 16S rDNA primers ...
-
bioRxiv - Plant Biology 2024Quote: RNA was extracted from five-day-old green seedlings with or without four hours of 27°C treatment of each genotype using the RNeasy Plant Kit (Qiagen). For mRNA sequencing (mRNA-seq ...
-
bioRxiv - Systems Biology 2024Quote: DNA for Nanopore sequencing was purified from frozen samples stored at -80 °C using a Blood & Cell Culture DNA Midi Kit (Qiagen). Approximately 100 mg of tissue sample was crushed in a BioPulveriser cooled in liquid nitrogen ...
-
bioRxiv - Zoology 2024Quote: ... involved proteinase K digestion at 55°C using 20 µl of proteinase K and 220 µl of ATL lysis buffer (MinElute Reaction Cleanup kit, Qiagen). Prior digestion ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were collected and frozen at −20°C until DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen) according to the Protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated at 37 °C for 30 min followed by immediate purification of DNA fragments with the MinElute PCR Purification Kit (Qiagen). ATAC-seq including amplification of Library and Indexing was performed as described elsewhere67 ...
-
bioRxiv - Immunology 2024Quote: ... Cytosolic fractions were prepared by centrifugation at 10,000 × g for 30 min at 4°C and DNA was isolated from them using the DNeasy Blood & Tissue kit (Qiagen). The copy number of mitochondrial DNA encoding 16S RNA (RNR2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lysed cell material was stored overnight at −80 °C before total RNA was isolated using the RNeasy Plus Mini Kit (Qiagen). RNA isolation and RT-qPCR was performed by the University of Rochester Genomics Research Center ...
-
bioRxiv - Developmental Biology 2023Quote: ... These were stored at -80°C before RNA extraction using Pre cellys bead homogenisation (Bertin Technologies, France) and RNA easy Kit (Qiagen). Turbo DNA free DNase kit (Ambion ...
-
bioRxiv - Biochemistry 2024Quote: ... Total RNA was extracted from the supernatant (12,000 x g for 10 min at 4°C) of centrifuged tissue homogenate using an RNeasy Mini Kit (Qiagen, USA). The extracted total RNA was used for single-strand cDNA synthesis ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from the cells dissociated with C&H or dispase or from fresh frozen tissues using RNeasy plus mini kit (#74134, Qiagen). 500 ng of RNA from each sample was used for cDNA synthesis using High-capacity RNA-to-cDNA kit (#4387406 ...
-
bioRxiv - Cancer Biology 2020Quote: Human cancer stem cells RT2 Profiler PCR arrays were purchased from Qiagen (Cat# PAHS-176ZA-12) and used in combination with a 7900 HT real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... QIAseq FastSelect rRNA removal agent (Qiagen, Cat #334386) consists of ONTs complementary to ribosomal RNA sequences ...
-
bioRxiv - Genomics 2021Quote: ... bead cleanup and QIAGEN FastSelect HMR rRNA (QIAGEN) depletion ...
-
bioRxiv - Molecular Biology 2023Quote: DNase-treated RNA was rRNA-depleted (Qiagen, 334215) and stranded libraries were prepared by Genome Québec ...
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... Mitochondria were purified from approximately 2*106 cultured HeLa cells continuously expressing the mitochondrial matrix marker su9-mCherry using the Qproteome Mitochondria Isolation Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Mitochondrial and nuclear DNA was isolated from pupae 9 days after egg hatching using the DNeasy Blood & Tissue kit (Qiagen). A total of 50 ng genomic DNA was used as a template to perform qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... All 16S rRNA gene amplicons were purified from 1.5 % agarose gels using the QIAquick Gel Extraction Kit (Qiagen), quantified with the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Luciferase reporter constructs were either mock-treated or methylated in vitro with SssI CpG methyltransferase for 4 h at 37 °C and purified with the QIAquick Purification Kit (QIAGEN 28704). Reporter plasmid (500 ng ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The reaction was incubated at 37°C for 30 min and purified using a MinElute Reaction Cleanup Kit (Qiagen, Germantown, MD). The PCR reaction consisted of 30 μl transposed DNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bacterial cells were pelleted by centrifugation at 6,000 RCF at 4°C for 15 minutes and plasmid DNA was extracted using a Qiagen Plasmid Plus Midi Kit (Qiagen #12943). To estimate the total number of unique barcodes present in the plasmid pool ...
-
bioRxiv - Genomics 2019Quote: ... The fresh blood sample was immediately brought to the laboratory at 4 °C and genomic DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, USA) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... incubated overnight at 37°C in L-broth containing 50 ng/μL ampicillin and DNA isolated using the QIAprep Spin Miniprep kit (Qiagen 27104) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... treated with DNase I at 37°C for 30 min and finally cleaned with the miniElute kit (QIAGEN, Catalog Number: &28004). For next-generation sequencing ...
-
bioRxiv - Evolutionary Biology 2021Quote: We homogenized tongue or ear tissue (stored at −20°C) and extracted genomic DNA using QIAamp Fast Tissue kits (Qiagen, Inc), with verification via gel electrophoresis (2% agarose) ...
-
bioRxiv - Genomics 2021Quote: ... The resultant nuclei were then incubated for 30 min at 37°C with an in-house made Tn5 enzyme and purified with the Qiagen MinElute kit (Qiagen, 28004). PCR reactions for each replicate were performed with 15 cycles using Ad1F and Ad2.2R primers and NEBNext High-Fidelity 2X PCR Master Mix (New England Labs Cat #M0541) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the PCR products were held at 4°C until PCR purification using the QIAquick PCR purification kit (#28106, Qiagen, Hilden, Germany). DNA concentrations were determined using NanoDrop 2000 (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... harvested and stored at −80°C in RLT buffer with β-mercaptoethanol from the RNeasy Mini prep Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions until cDNA synthesis for RT2 Profiler PCR array ...
-
bioRxiv - Microbiology 2021Quote: ... Fecal pellets were snapfrozen and stored at −80°C until DNA extraction with the DNeasy Powersoil kit by Qiagen (Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Transposition was performed for 30 minutes at 37°C after which the transposed DNA was purified using MinElute PCR Purification Kit (Qiagen, 28004) and eluted in 10 µl of elution buffer (EB ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Microbiology 2019Quote: ... the supernatant was removed with a micropipet and 350 µL of 4°C Buffer RLT Plus (from Qiagen RNeasy Mini Kit) was added to the pellet to collect the RNA ...
-
bioRxiv - Zoology 2020Quote: ... SDS and 100 µg/ml proteinase K) and incubated at 56°C for 1 h before extraction using a QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer’s directions ...
-
bioRxiv - Neuroscience 2019Quote: ... Buffer RLT containing immunoprecipitated RNA was then eluted and stored at −80°C until clean up using a kit (Qiagen 154025593). cDNA was generated using 11 rounds of amplification with 10 ng RNA input.
-
bioRxiv - Biochemistry 2019Quote: ... genomic DNA was de-crosslinked in ChIP elution buffer containing 5 M NaCl at 65 °C overnight and purified with the Qiaex II kit (Qiagen, 20021) and eluted in water for PCR amplification ...
-
bioRxiv - Neuroscience 2021Quote: ... Buffer RLT containing immunoprecipitated RNA was then eluted and stored at −80 °C until clean up using a kit (Qiagen 74004). cDNA was generated using 11 rounds of amplification with 10 ng RNA input ...
-
bioRxiv - Cell Biology 2020Quote: Isolated Chromatin was digested with 1% proteinase K for 2 hrs at 60 °C with 300 rpm and was subsequently purified by using QIAquick® Nucleotide Removal Kit (28306, Qiagen) according to the manufactory’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting 1.5 L bacterial culture was incubated at 37°C for 2h and a Maxiprep performed using Qiagen MaxiPlus kit (Qiagen #12963) to a resulting 1 mg of plasmid DNA ...