Labshake search
Citations for Qiagen :
301 - 350 of 2762 citations for HLA A*0201 WT 1 complex Protein Human HEK293 His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: Total RNA from WT and Lap2α(ΔHep) mice was isolated using RNeasy Mini Kit (Qiagen), and cDNA was synthesized using iScript cDNA Synthesis kit (BIO-RAD CA ...
-
bioRxiv - Developmental Biology 2023Quote: ... pA-GFP-HDAC1 wt/S391A/S391D were transfected into S2R+ cells using Effectene (Qiagen, 301425). 24 hours post transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... The 1131 bp KI band and 351bp WT allele band were gel purified (Qiagen, #28604) and sequenced to check for potential mutations introduced during editing ...
-
bioRxiv - Biophysics 2024Quote: ... The WT and mutant Pcads were then affinity purified with Ni-NTA agarose beads (Qiagen) in a gravitational column ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from WT and Rx3KO HGC-27 cells and analyzed by Qiagen R2 Profiler kits ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from mouse (NPsh-1-IDH2WT, NPsh-1-IDH2R172K) and human cells (RBE) with the RNAeasy extraction kit (Qiagen). Bulk RNA-SEQ of NPsh-1-IDH2WT ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Biophysics 2021Quote: ... coli and purified by His-tag affinity purification using Ni-NTA agarose beads (Qiagen) followed by ion exchange purification using a mono-Q HR 5/5 column (GE Healthcare) ...
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Bioengineering 2021Quote: ... The complex (12 mg/ml) was screened for crystallization using the 384 conditions of the JCSG Core Suite (Qiagen) on our custom-designed robotic CrystalMation system (Rigaku ...
-
bioRxiv - Microbiology 2020Quote: ... The complex (7.5 mg/ml) was screened for crystallization using the 384 conditions of the JCSG Core Suite (Qiagen) on our custom-designed robotic CrystalMation system (Rigaku ...
-
bioRxiv - Molecular Biology 2024Quote: ... and RNase inhibitors) and RNA-IKKα complex was pulled down by Ni2+-NTA Agarose Beads (Qiagen cat. no. 30230) or IKKα antibody ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the three HEK293 cell lines after 48 h in culture using the RNeasy Protect Mini Kit (catalog #74124, Qiagen). After reverse transcription (Super-Script II reverse transcriptase ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: I21 WT and C3575S cDNAs were cloned in a custom made pQE80-based expression plasmid (Qiagen) using BamHI and BglII restriction enzymes (sequences available in Supplementary File S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tissue taken from naïve WT GFAP-GFP animals was immediately placed into QIAzol Lysis Reagent (QIAgen) and processed using the manufacturer’s protocol as previously reported [24] ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA isolation from SF3B1K700E and WT ES cells was performed using the RNeasy Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana WT Col-0 genomic DNA was extracted using the DNeasy Plant Mini Kit (Qiagen). Approximately 2 μg of sheared genomic DNA was repaired and end-prepped with NEBNext FFPE DNA Repair Mix and Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Microbiology 2022Quote: ... BapR-CPD-His was affinity purified from cleared lysates using Ni-NTA agarose beads (Qiagen) with gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... containing an N-terminal His-tag was removed on a Ni-NTA agarose column (Qiagen). Proteins were additionally purified through a Superdex 200 26/60 size exclusion column (Pharmacia Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... MCP (His-HaloTag-2xMCP) was purified using its histidine tag with Ni-NTA Agarose (Qiagen) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Microbiology 2023Quote: ... and were probed with either horseradish peroxidase (HRP)- conjugated primary antibodies against His-tag (Qiagen) or with rabbit primary antibodies against HA-tag (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... The His-tagged IA2 was then purified with a NiNTA Agarose bead (Qiagen, Cat#1018244) packed column fraction collection ...
-
bioRxiv - Cell Biology 2024Quote: ... into 4 million HEK293-GP cells in 300 µl Buffer EC with 16 µl Enhancer and 60 µl Effectene Transfection Reagent (Qiagen 301425) (Morgenstern and Land ...
-
bioRxiv - Microbiology 2020Quote: ... The eluant was treated with DNase I (1 U/μl) to digest non-specific DNA and the bound DNA was purified from the complex via PCR Qiagen Kit (Qiagen). The purified DNA was amplified with primer sets specific to the prrF1,F2 promoter (Table S2 ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from RPE/choroid complex and primary RPE cells using a RNA extraction kit (RNeasy plus mini kit QIAGEN). The RNA concentration and integrity were determined with NanoDrop 1000 spectrophotometer ...
-
bioRxiv - Biochemistry 2023Quote: ... and the complex of RAD51 and MBP-BRCA2 BRC4 was purified from clarified lysate through consecutive amylose and Ni-NTA (Qiagen) affinity chromatography ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was clarified by centrifugation and the MRT-CRBN-B11/DDB1-B05 complex was captured by immobilized metal affinity chromatography using Ni-NTA resin (Qiagen) and eluted with 300 mM imidazole ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... plasmid encoding Cas9 and gRNA or WT control organoids using QIAamp Fast DNA Tissue Kit (51404, Qiagen). PCR was performed using PrimeSTAR® GXL DNA Polymerase (R050A ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae D39 WT and all FQ-resistant mutants using the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s recommendations for Gram-positive bacteria ...
-
bioRxiv - Immunology 2020Quote: Total RNA from WT and STAT3 SA peritoneal macrophages was isolated using the RNAeasy Isolation Kit (Qiagen) and reverse transcribed with random hexamers (Life Technologies ...
-
bioRxiv - Immunology 2024Quote: RNA from human THP-1 macrophages (MACs was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... human TRPV4 and human Cx43 were amplified and purified using the HiSpeed® MidiKit (Qiagen). To identify Cx43 expression/distribution ...
-
bioRxiv - Immunology 2022Quote: ... The cleaved protein was passed over a 1 mL Ni-NTA agarose (Qiagen) gravity column to remove TEV protease ...
-
bioRxiv - Molecular Biology 2023Quote: The eluted protein was mixed with 1 ml Strep-Tactin Superflow agarose (Qiagen) and incubated at 4 °C for 30 min ...