Labshake search
Citations for Qiagen :
301 - 350 of 1951 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Biophysics 2023Quote: TSA measurements were carried out on a Rotor-Gene Q 6 plex (Qiagen, Germany) instrument at a heating rate of 2 °C/min and a temperature range of 25−90 °C in the presence of a CPM dye ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 nM siRNAs were mixed with 6 µl of HiPerFect transfection reagent (Qiagen, #301707) in 100 µl of serum free DMEM and added to freshly plated cells drop by drop ...
-
bioRxiv - Microbiology 2024Quote: ... Tissues were homogenized at 300 Hz for 6 minutes using the TissueLyser II (QIAGEN). Homogenized samples were serially diluted at 1:10 in PBS ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was purified from 6-week-old GABAergic neurons using Rneasy kit (Qiagen). Dnase I on-column digestion was performed to avoid genomic DNA contamination.
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: SUZ12 isogenic M3 MPNST cells were treated with or without DNMT inhibitors (50 nM daily Decitabine or 4 μM single dose of GSK862) for 4 days followed by genomic DNA isolation with Gentra Puregene cell kit (Qiagen). Bisulfite sequencing was conducted by the IGO core facility at MSKCC ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Biochemistry 2024Quote: ... the suspension was diluted 4 times and incubated for 1 hour at 4°C with 200 µL of Ni-NTA agarose (Qiagen) preequilibrated in the lysis buffer ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase Inhibitor (4 unit/µl) (cat # 1055213, Qiagen), rRNasin Rnase inhibitor (40 U/µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4) DNeasy Plant Mini Kit (QIAGEN®) combined with the InhibitEx Buffer step from the QIAamp DNA Stool Mini Kit to improve inhibitor removal ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of 100 mg/mL RNase (Qiagen) was added ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen): cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... after 4 h of coculture (Qiagen, Montreal, Canada). Reverse transcription of isolated RNA was performed using the Maxima First Strand Kit (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... RNase A (4 µL, 100 mg/mL, Qiagen) was added to remove RNA and incubated at 25°C for 2 min ...
-
bioRxiv - Genomics 2020Quote: ... water re-suspended nucleic acids were further cleaned using an RNA extraction kit (Qiagen, Germany) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... nucleic acid extraction was performed using 280 μL of each sample in duplicate by Qiagen viral RNA extraction protocol and quantified RNA was further processed for template preparation using the Ion Chef System ...
-
bioRxiv - Genomics 2020Quote: ... cfDNA was extracted from plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Valencia, California) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... CRY2 protein was isolated by Ni2+-nitrilotriacetic acid (Ni-NTA) affinity chromatography (Qiagen, Hilden, Germany) following elution with 50 mM Tris buffer pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal DNA was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Cancer Biology 2020Quote: Cell-free DNA (cfDNA) was isolated using QIAamp Circulating Nucleic Acid Kit (Qiagen®, Germany) from different volumes of plasma samples (850µl to 2ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nucleic acids were extracted from leech samples using the DNeasy 96 Blood & Tissue kit (Qiagen) (see Axtner et al ...
-
bioRxiv - Microbiology 2022Quote: ... nucleic acid was extracted from the tissue sample using QIAamp DNA extraction kit (Qiagen, Germany) as per the recommended protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tumor nucleic acid extractions were performed using the Allprep DNA/RNA/miRNA Universal kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the QIAamp Circulating Nucleic Acid kit (kit Q; cat# 55114, Qiagen, Germantown, MD, USA).
-
bioRxiv - Microbiology 2020Quote: Total nucleic acid was extracted from respiratory specimens using a QIAamp DNA Mini Kit (QIAgen), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The soluble fraction was passed through 3ml of nickel nitrilotriacetic acid agarose (Ni-NTA) (Qiagen), washed with 20 mM imidazole ...
-
bioRxiv - Cell Biology 2021Quote: The locked nucleic acid-modified oligonucleotides with a fully phosphorothioate backbone were produced by Qiagen as described (Rossiello et al ...
-
bioRxiv - Developmental Biology 2020Quote: DNA was extracted from blood on an automated nucleic acid extraction platform called QiaSymphony (Qiagen) with a magnetic bead-based extraction kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... cfDNA was extracted from 4ml of plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN, 55114), it was quantified via Qubit Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CSF3R protein was enriched by nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen 30210) and further purified by size-exclusion chromatography on a Superdex 75 10/300 GL column (Cytiva 17517401 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Genomic nucleic acid isolation was performed using the MagAttract HMW DNA Kit (Qiagen, Hilden Germany) precisely following the instructions of the fresh or frozen tissue protocol ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Recombinant Fab proteins were purified from the culture supernatant by nickel-nitrilotriacetic acid agarose (Qiagen). Recombinant mAbs were affinity purified by MabSelect resin (Cytiva ...
-
bioRxiv - Genomics 2024Quote: ... CfDNA was extracted from the plasma samples using the QIAamp Circulating Nucleic Acid Kit (Qiagen) and approximately 3 – 8 ng of cfDNA was isolated from each plasma sample for use in the 5hmC-Seal assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribonucleic acid (RNA) was extracted and purified using RNeasy RNA Isolation Kit (QIAGEN, Germantown, MD) then reverse transcribed into complementary deoxyribonucleic acid (cDNA ...
-
bioRxiv - Genomics 2022Quote: ... Viral nucleic acids were then isolated using QIAamp MinElute Virus Spin Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions with some modifications described (Cosentino et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... A locked nucleic acid probe (mmu-miR-450b-5p miRCURY LNA miRNA Detection probe; Qiagen) was used to detect miR-450b while standard DNA oligonucleotide probes were used for other miRNAs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and nucleic acid was extracted using EZ1 Advanced XL extraction with a Virus Card (QIAGEN). Six of the 20 FACS populations did not generate sufficient DNA and were not subsequently sequenced ...
-
bioRxiv - Developmental Biology 2023Quote: DNA was extracted from blood on an automated nucleic acid extraction platform called QiaSymphony (Qiagen) with a magnetic bead-based extraction kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clarified supernatant was loaded onto pre-equilibrated nickel-nitrilotriacetic acid (Ni-NTA) (Qiagen, USA) affinity column and flow-through was collected after incubation for 30 min at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was purified by incubation with nickel-nitriloacetic acid (Ni-NTA) agarose resin (Qiagen) for 3h at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was extracted using the Qiagen RNA nucleic acid extraction kit (Qiagen, Hilden, Germany) at 0- ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...