Labshake search
Citations for Qiagen :
3351 - 3400 of 3857 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 4 µM resazurin) to decrease the initial DDM concentration to 0.5% and incubated with nickel nitrilotriacetic acid (Ni2+-NTA) resin (Qiagen) for 1h at 4 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was extracted from roots or shoot of plants 6 DAG using RNA easy kit (Qiagen, Hilden, Germany). RNA was treated with DNAse using the Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 12-273 BM cells at 80% confluence in 6 well plates using the RNeasy Mini Kit (Qiagen 74104). 600 ng of RNA was subjected to DNase I treatment and reverse transcription ...
-
bioRxiv - Cell Biology 2019Quote: ... 1.2×106 S2R+ cells were seeded onto each well of a 6-well plate and transfected using Effectene (Qiagen) with either pAc-Eff1-HA (150 ng) ...
-
bioRxiv - Microbiology 2021Quote: ... for 30 min at 37 °C followed by bead-beating with 50 μg 0.1 mm of zirconium beads for 6 min on the Tissuelyzer II (Qiagen) prior to loading onto the Qiacube HT ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was isolated from hESCs or NPCs grown in a 6-well plate (9.5 cm2) using the RNeasy minikit (Qiagen). A DNase 1 digestion step was performed during RNA extraction to degrade remaining genomic DNA ...
-
bioRxiv - Cancer Biology 2019Quote: FTE cells were harvested from 6 cm plates and RNA was isolated using miRNAeasy micro kit (Qiagen, Hilden, Germany). Quantity and quality of total RNA was analyzed using Nanodrop (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... or IFNγ (10ng/mL) for 6 hours prior to harvesting and RNA extraction using RNeasy Mini Kit (Qiagen 74106). Next ...
-
bioRxiv - Molecular Biology 2019Quote: 1×106 MIA PaCa-2 or HAP1 cells were seeded per 6 well plate and co-transfected with 0.5 µg pCas-Guide plasmid using Effectene transfection reagent (Qiagen). 24 hrs after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were then seeded in 6-well dishes (6x105 cells/well) and reverse transfected using Polyfect (Qiagen, 301105) following the manufacturers protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The expressed recombinant protein was solubilized in a denaturing buffer (6 M HCl-Guanidine, 20 mM Tris-HCl[pH 7.5] and purified by Ni-NTA (30210, QIAGEN) under denaturing conditions ...
-
bioRxiv - Cell Biology 2022Quote: Cells were grown in 6 well plates and total mRNA was isolated using the RNeasy Kit (Qiagen, 74-104) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... after adding 1.0×10^6 copies/µL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... solubilized in a denaturing buffer (6 M HCl-Guanidine, 20 mM Tris-HCl pH 7.5) and purified by Ni-NTA (QIAGEN) under denaturing conditions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid transfections were performed in six-well tissue-culture treated dishes at 1.8 × 10^6 cells/ml using Effectene (301427; QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted from ∼70% confluent HeLa cells grown in 6-wells plate using the RNeasy Micro Kit (Qiagen) with a DNase step according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2024Quote: Total mRNA was isolated from 6 hpf to 5 dpf zebrafish homogenates using an RNeasy Mini Kit (Qiagen, 74106) and reverse-transcribed with iScript (Bio Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... After 14 h binding to 4 mL Ni-NTA agarose beads (Qiagen), the beads were first washed with 15 mL Ni-NTA binding buffer and then with 15 mL Ni-NTA wash buffer (1 M NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 µL of DNA) and run in Rotor-Gene Q machine (QIAGEN). Primer sequences are listed in the table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Sample supernatants were incubated with 4 mL of Ni-NTA Agarose (Qiagen) for >1 hour at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Microbiology 2022Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Genomics 2022Quote: ... and 4 µl of 100 mg/ml RNase A (QIAGEN, cat# 19101) were added to the homogenate ...
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl of DNA) and run in Rotor-Gene Q machine (Qiagen). Primer sequences are listed in the Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Removed culture was mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) for stabilization and incubated for 5 min at room temperature before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... with 4 × 108 copies of cel-miR-39 miRNA mimic (Qiagen 339390) spiked into to the sample after addition of lysis buffer.
-
bioRxiv - Neuroscience 2023Quote: ... At least 4 colonies were used for each DNA miniprep (QIAprep, Qiagen) and mutations were confirmed by Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... The siRNAs were selected from the FlexiTube GeneSolution 4 siRNA sets (Qiagen) and transfected as a mix at 24 nM in Calu-3 and 10 nM in Caco-2 following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7.5 at 4°C) and purified using the RNAeasy kit (Qiagen).
-
bioRxiv - Immunology 2024Quote: ... and 4 weeks post-transduction using the DNeasy Blood & Tissue kit (Qiagen). Genomic DNA was also extracted from HEK293T cells used for lentiviral production to confirm baseline sgRNA frequencies ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was extracted from frozen samples using two acid phenol-chloroform-isoamyl alcohol extractions and immediately purified using the RNEasy MinElute kit (Qiagen). Ribosomal RNA (rRNA ...
-
bioRxiv - Genomics 2019Quote: ... Four hundred µL of 70% ethanol were added and nucleic acid extraction was immediately done with the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... We extracted total genomic DNA from blood and/or tissue samples using standard nucleic acid extraction kits (QIAamp DNA Mini Kit; Qiagen) automated on a QiaCube (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). Polyclonal rabbit antisera were raised by Covance Research Products Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from stool samples using the RNeasy PowerMicrobiome kit automated on the QIAcube (Qiagen, Germantown, MD, USA), excluding the DNA degradation steps ...
-
bioRxiv - Microbiology 2021Quote: ... Total Nucleic Acid (TNA) was extracted from using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). Autopsy tissues were collected from lung ...
-
bioRxiv - Biophysics 2021Quote: ... MHC II with C-terminal hexahistidine tags on both α and β chains were expressed using a baculovirus expression system in S2 cells and purified using a Ni–nitrilotriacetic acid (NTA) agarose column (Qiagen). The histidine-tagged MHC bacmid (Malherbe et al. ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were diluted further with RTL buffer to give a 1:60 w/v homogenate and total nucleic acid was extracted from 300 μl of the clarified sample using the RNA tissue mini kit without DNase (Qiagen) and eluted in a 60 μl volume.
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from yeast cells using either the acid phenol-chloroform method or an RNeasy Mini kit with on-column removal of DNA (Qiagen), both as previously described 28 ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: His-FlhAC and His-FlgN were purified by Ni affinity chromatography with a nickel-nitriloacetic acid (Ni-NTA) agarose column (QIAGEN) as described previously12 ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit and the following locked nucleic acid (LNA) SYBR green primers from Qiagen: mmu-miR-598-3p ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated by extraction with hot acid phenol essentially as described in (67) and purified using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...