Labshake search
Citations for Qiagen :
3301 - 3350 of 3706 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Microbiology 2020Quote: Airway epithelia cultured on 6.5-mm Transwell membranes were washed and treated for 1 minute at RT with RLT buffer (Qiagen) with 1% β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cancer-associated fibroblasts (CAFs) and C666-1 cells using RNeasy Mini kit per the manufacturer’s instructions (Qiagen, Hilden, Germany). RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were confirmed by agarose gel electrophoresis using 0.8-1% agarose and purified using PCR purification kit (Qiagen). In case of NS1 gene ...
-
bioRxiv - Microbiology 2021Quote: ... with sequences and concentrations listed in Table 1 in combination with QuantiTect Multiplex PCR Kit (Qiagen, Germantown, MD, USA). PMAxx (Biotium ...
-
bioRxiv - Microbiology 2022Quote: Frozen tissue was partially thawed and submerged in lysis buffer containing 1% β-mercaptoethanol and 0.5% Reagent DX (Qiagen) before tissues were homogenised together with TissueRupture (Qiagen) ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products of the expected size were excised from a 1 % w/v agarose gel and purified using the QIAquick gel extraction kit according to the manufacturer’s protocol (Qiagen). The cDNA fragment was inserted into the pCR4-TOPO® vector and transformed into OneShot® chemically competent E ...
-
bioRxiv - Microbiology 2020Quote: ... adjusted to pH 8.0 using 1M Tris-HCl pH 8.0 and incubated at room temp for 1 h with Ni-NTA Agarose beads (Qiagen). Beads were washed twice with PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Genetics 2019Quote: ... mixed with 1 volume of 70% ethanol and then transferred to a RNeasy MinElute column (Qiagen, Hilden, Germany: 74204) for purification following the standard protocol ...
-
bioRxiv - Systems Biology 2020Quote: DNA was isolated from CAMA-1 and CAMA-1_ribociclib_resistant cells using DNeasy Blood & Tissue Kit (Qiagen, Cat. No.: 69504) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: The solubilized protein was incubated for 1 hour with washed and pre-equilibrated Strep-Tactin Superflow plus resin (Qiagen). The resin was then loaded into an Econo-Column Chromatography Column (Biorad ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Five days later 1×107 cells were harvested and DNA isolated for sequencing (QIAamp DNA Blood Midi Kit, Qiagen). For each experimental condition (mock ...
-
bioRxiv - Genetics 2020Quote: ... The PCR product was separated on a 1 % agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen). 60 ng of each probe were labeled with dATP [α-32P] (DECAprime kit II ...
-
bioRxiv - Molecular Biology 2019Quote: Genomic DNA was extracted from mantle or arm tissue (~1 mm3) using a DNeasy Blood and Tissue Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The amplified genes were then electrophoresed in 1% agarose gel followed by purification using PCR purification kit (Qiagen, USA). Both purified genes and plasmids were digested with Nde I and Not I prior to ligation using the T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... gDNA was purified from THP-1 cells using the QIAmp DNA mini and blood extraction kit (QIAgen, Manchester, UK) as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... and an aliquot of 300-500uL was immediately mixed at 1:2.76 volume ratio with fluid from a Paxgene blood RNA tube (Qiagen), whilst the remainder was stored on ice for flow cytometry analysis ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was extracted from DF-1 cells and HH27 whole chick heads using the RNeasy Plus Kit (Qiagen, 74136) following the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2020Quote: ... and A10 encoding constructs or 1 μg Shh constructs with or without 0.5 μg Scube2 by using Polyfect (Qiagen). Cells were grown for 2 days or 3 days for Disp−/− rescue experiments at 37°C with 5% CO2 in DMEM containing 10% fetal calf serum and penicillin-streptomycin (100 μg/mL) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were analyzed on a 1% agarose gel and bands gel purified using QIAquick gel extraction kit (Qiagen). Samples were sequenced via Sanger sequencing (Genewiz ...
-
bioRxiv - Molecular Biology 2020Quote: ... 15uL of the sample was de-crosslinked overnight at 65°C with 85ul of decrosslinking buffer (0.1M NaHCO3, 1% SDS) before clean up using QiaQuick PCR clean up kit from Qiagen.
-
bioRxiv - Cell Biology 2019Quote: ... Total RNA was isolated following the manufacturer’s protocol and cDNA was synthesized from 1 µg total RNA using the QuantiTekt Reverse Transcription kit (Qiagen). The primers used for detecting Ccdc186 cDNA were:
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was lysed with a lysis buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 20 mM EDTA, 1% SDS) and proteinase K (Qiagen) was added to samples to degrade proteins ...
-
bioRxiv - Immunology 2022Quote: ... The complementary DNA (cDNA) was synthesized from 1 μg of total RNA using QuantiTect Reverse Transcription Kit (Qiagen: 205311) and quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of extracted RNA from each sample was used for the cDNA synthesis (cDNA synthesis kit, Qiagen, Germany) according to the suppliers’ protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-seq libraries were prepared from 1 μg total RNA using the QIAseq FastSelect -rRNA Yeast kit (Qiagen 334217) and QIAseq Stranded RNA Library kit (Qiagen 180743 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 µg of each sample was used to prepare 20 µL cDNA using RNeasy Plus Mini Kit (Qiagen). Human RT2 Profiler™ PCR Array ...
-
bioRxiv - Physiology 2022Quote: ... Lysates were centrifuged at 100,000 x g for 1 h and the supernatant were affinity purified on Ni-NTA resin (Qiagen) by batch binding for 30 min-1h ...
-
bioRxiv - Microbiology 2022Quote: Airway epithelium cultured on 6.5-mm Transwell membranes was washed and treated for 1 min at RT with RLT buffer (Qiagen) with 0.01 % β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2024Quote: ... 72 °C for 1 min and then subjected to a 1.2x SPRI cleanup eluting in 42 µl EB buffer (Qiagen). Each sample was split into two fractions and each of them was further amplified with modality-specific primers ...
-
bioRxiv - Microbiology 2024Quote: ... Material was ruptured two times for 1 min at 30 Hz in a TissueLyser (Qiagen Inc., Germantown, MD, USA). Between and after these two steps of tissue disruption ...
-
bioRxiv - Genomics 2023Quote: ... After overnight proteinase K digestion in Lysis Buffer (BNG) and 1-hour treatment with RNAse A (Qiagen, MD,USA), plugs were washed 4 times in 1×Wash Buffer (BNG ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was isolated from 1 × 106 BMDM from WT or p38γ/δKIKO male mice using the RNeasy kit (QIAGEN). Biological replicate libraries were prepared using the TruSeq RNA library prep kit (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... Primers were designed using the NCBI primer-designing tool (see Table 1) or ordered as validated primers from Qiagen. The mRNA expression levels were plotted as relative gene expression to β-actin (2-ΔCt) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was analyzed on an agarose gel (1%) and purified by using the QIAquick gel extraction kit (Qiagen #28706). DNA was then digested and primer dimers were ligated at 16°C overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA (1 μg) was treated with DNase and converted into cDNA using the QuantiTect Reverse Transcription kit (Qiagen), according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were treated with Angiotensin-II (1 μM) alone or in combination with DAPT (10 μM) or siNotch1 (Qiagen) (50 nM ...
-
bioRxiv - Bioengineering 2023Quote: ... total RNA was extracted from about 1 × 106 cells from all groups using RNeasy Mini Kit (Qiagen, Valencia, CA), then using the random hexamer primer and M-MuLV reverse transcriptase kit (Fermentas ...
-
bioRxiv - Cancer Biology 2023Quote: ... V2 and V3 amplicons were resolved in the 1% agarose gel and purified using the gel purification kit (Qiagen). Each cDNA was cloned into pDONR201 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA (gDNA) was extracted from J-Lat cells 10.6 and HIV-1 negative CD4+ T cells with the QIAcube (Qiagen), using the QiaAmp DNA mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Rainbow proviral HIV-1 DNA dPCR assay was performed on a QIAcuity Four digital PCR platform (Qiagen, Germany) with at least 500 ng (CD4+ T cell ...
-
bioRxiv - Immunology 2023Quote: ... and approximately 1 µg of isolated RNA was converted to cDNA using RT2 First Strand Kit (Qiagen, Hilden, Germany). cDNA was diluted (1:10 ...
-
bioRxiv - Systems Biology 2023Quote: ... Large fragments (200-400 bp) were extracted from a 1% agarose gel with QIAquick Gel Extraction Kit (Qiagen, Netherlands). The final library was sequenced as 85 bp long single-end reads on a NextSeq™ 550 (Illumina ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.