Labshake search
Citations for Qiagen :
3301 - 3350 of 10000+ citations for Human Xylosyltransferase 1 XYLT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells using an RNeasy mini kit (Qiagen) after lysis with lysozyme (FujiFilm Wako ...
-
bioRxiv - Developmental Biology 2019Quote: ... and RNA extraction kits following manufacturer’s instructions (QIAGEN RNeasy Plus Mini Kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... and extracted with a QIAfilter midi kit (Qiagen).Sanger sequencing was utilized to confirm the presence of the desired mutation ...
-
bioRxiv - Genetics 2019Quote: ... purified using the QIAquick PCR purification kit (QIAGEN) and sub-cloned into pGEMT-easy (Promega) ...
-
bioRxiv - Physiology 2020Quote: ... cleaned-up using the RNeasy kit (Qiagen, UK) and cDNA was synthesized with the High Capacity cDNA Trancription kit (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified using the RNeasy Mini Kit (QIAGEN). After RNA integrity was confirmed using an Agilent RNA 6000 Nano Chip (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... were purified by MinElute PCR Purification Kit (QIAGEN), and were fragmented by Picoruptor (Diagenode ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4) DNeasy Plant Mini Kit (QIAGEN®) combined with the InhibitEx Buffer step from the QIAamp DNA Stool Mini Kit to improve inhibitor removal ...
-
bioRxiv - Microbiology 2019Quote: ... cinerea using DNeasy Plant Mini Kit (Qiagen, Germany). DNA sequencing library was prepared with insert size of 270 bp and sequenced with Illumina HiSeq® 4000 at the 2×150 bp paired-end read mode ...
-
bioRxiv - Microbiology 2019Quote: ... performed using the DNeasy Blood & Tissue Kit (Qiagen). Genomic DNA was eluted in a final volume of 200 µL ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was prepared using RNeasy Kit (Qiagen) according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... and RNA isolated with RNeasy Mini Kit (Qiagen). RNA was treated with DNase I ...
-
bioRxiv - Microbiology 2020Quote: ... and an RNase-free DNase-free Kit (Qiagen). The RNA sample was reverse transcribed with Transcriptor Universal cDNA Master (Roche Diagnostics ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was purified using RNeasy extraction kits (Qiagen) with a DNase (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... or using the DNEasy Blood & Tissue kit (Qiagen) according to the kit instructions and including the optional Proteinase K treatment ...
-
bioRxiv - Microbiology 2021Quote: ... or plasmids (QIAprep® Spin Miniprep Kit, Qiagen). Polymerase chain reaction (PCR ...
-
bioRxiv - Microbiology 2021Quote: Plasmid DNA was isolated using miniprep kits (QIAGEN), with modifications for GBS as described elsewhere (32) ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted using the RNeasy kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated using Plant RNAeasy kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA was isolated using RNeasy kit (Qiagen) and cDNA was generated using iScript Advanced cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA was isolated using RNeasy kit (Qiagen) and cDNA was generated using iScript Advanced cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Pathology 2020Quote: ... and RNeasy® Mini Kit (Qiagen, cat# 74104) coupled with on-column DNaseI treatment (Qiagen cat#79254 ...
-
bioRxiv - Molecular Biology 2020Quote: ... QIAShredder and RNeasy Mini kits were from Qiagen. Anti-WWOX antibody was from abcam (Cambridge ...
-
bioRxiv - Cancer Biology 2020Quote: ... the Quantitect Reverse Transcription kit (Qiagen, Hilden, Germany) was used according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by cleanup with RNAeasy Mini kit (Qiagen). The Superscript III first-strand synthesis kit (Invitrogen ...
-
bioRxiv - Systems Biology 2019Quote: ... RNA was extracted using the RNeasy Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... RNA was extracted using the RNeasy Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted with the miRNeasy kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the QiaAmp Blood mini kit (250, Qiagen) consisting of AL ...
-
bioRxiv - Biochemistry 2021Quote: Total RNA was isolated using RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and genomic DNA was isolated (Puregene kit, Qiagen). Purified genomic DNA was digested overnight with XhoI ...
-
bioRxiv - Neuroscience 2020Quote: ... lysis buffer (RNeasy Micro Kit, Qiagen, Maryland, USA) with β-mercaptoethanol (10µl/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and expanded with REPLI midi Kit (Qiagen, 150043). SOD1 Exon 1 was expanded using 20 µM of forward (CTATAAAGTAGTCGCGGAGACGGGGTG ...
-
bioRxiv - Developmental Biology 2021Quote: ... treatment and purification with an RNEasy kit (Qiagen). Embryo trunks were sectioned at 16µm on a cryostat (Leica CM1900 ...
-
bioRxiv - Genomics 2019Quote: ... using the DNeasy Blood and Tissue Kit (Qiagen). To confirm that the tumours and germline DNA were derived from the same patient ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted using the RNeasy kit (Qiagen), RNA quality was checked with a Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... RNA was isolated using RNeasy FFPE Kit (Qiagen). Isolated RNA was resuspended in RNAse/DNAse free H2O (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was purified by a MinElute kit (QIAGEN) and resuspended in 40 μl of Elution Buffer ...
-
bioRxiv - Microbiology 2021Quote: The QIAamp DNA mini kit (Qiagen, Hilden, Germany) was used for DNA extraction from Sterivex® filters (EMD Millipore ...
-
bioRxiv - Immunology 2019Quote: ... and purified using RNeasy MinElute Cleanup Kit (Qiagen). Purity and integrity of RNA was assessed using a Bioanalyzer 2100 with a Eukaryote Total RNA Nano chip (Agilent Technologies).
-
bioRxiv - Immunology 2020Quote: RNA was prepared using RNeasy micro kit (Qiagen). RNA quantity and quality was assessed using a Nanodrop 1000 Spectrometer (Peqlab ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... columns or the QIAquick Gel Extraction kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... and RNA was isolated using RNeasy Kit (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The Multiplex PCR Kit (Qiagen GmbH, Hilden, Germany) was used for PCR and sequencing was performed with the BigDye Terminator v.3.1 ...
-
bioRxiv - Neuroscience 2019Quote: ... followed by the RNeasy MinElute Cleanup Kit (Qiagen). Genomic DNA extraction was performed using the DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was extracted using miRNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted by miRNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA was extracted (DNeasy 96 Plant Kit, Qiagen). Genotyping of segregating seedling populations was performed by PCR using primers listed in Methods S3 ...
-
bioRxiv - Biochemistry 2019Quote: ... by using QuantiTect® Reverse Transcription Kit (Qiagen) and qRT-PCR was performed as described (38) ...