Labshake search
Citations for Qiagen :
3551 - 3600 of 10000+ citations for Human Xylosyltransferase 1 XYLT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... or DNeasy Blood and Tissue Kit (QIAGEN, 69504) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... or the EndoFree Plasmid Maxi Kit (Qiagen, 12362). For in utero electroporations ...
-
bioRxiv - Molecular Biology 2022Quote: ... Using the Qiagen Mitochondria Isolation Kit (Qiagen #37612), we resuspend cell pellets in ice cold Lysis Buffer + Protease Inhibitor and 1 mM EGTA and incubate for 10 minutes rotating (end-over-end shaker ...
-
bioRxiv - Cell Biology 2022Quote: ... further purified with an RNeasy kit (74106, Qiagen), and prepared for RNA sequencing using TruSeq RNA Stranded mRNA (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a gel extraction kit (Qiagen, USA), dissolved in DEPC-treated water and stored at −80 °C until use.
-
bioRxiv - Genomics 2022Quote: ... RNA was isolated via RNeasy Micro Kit (Qiagen), and RNA quality was analyzed using a TapeStation (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... The QIAamp MinElute Virus Spin Kit (QIAGEN, Germany) was used for viral nucleic acid extraction ...
-
bioRxiv - Molecular Biology 2022Quote: ... column cleanup (Qiaquick PCR purification kit, QIAGEN, 28104) to remove enzyme was done and is a crucial step prior to pooling to prevent cross-cutting of other plasmids in the pool after combination by still-active enzymes.
-
bioRxiv - Microbiology 2022Quote: ... 33] and separated with an AllPrep kit (Qiagen). RNA was DNase treated (TURBO DNase ...
-
bioRxiv - Plant Biology 2022Quote: ... and converted with an EpiTect Bisulfite Kit (Qiagen). Converted DNA was PCR-amplified by MyTaq polymerase (Bioline ...
-
bioRxiv - Physiology 2022Quote: ... were isolated using the RNeasy Mini kit (QIAGEN) following the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... purified with a RNeasy kit (Qiagen, Maryland, USA) and stored at −70°C until use ...
-
Simultaneous adjunctive treatment of malaria and its co-evolved genetic disorder sickle cell anaemiabioRxiv - Microbiology 2022Quote: ... and QIAamp RNA Blood Mini Kit (52304, QIAGEN), respectively according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... MEFs at 80% confluence using DNeasy kit (Qiagen). DNA was quantified on a Nanodrop and diluted to 4ng/μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... A Qiagen RNeasy mini kit (Qiagen, cat#: 74106) was used to harvest RNA for RNAseq and qPCR ...
-
bioRxiv - Cell Biology 2022Quote: ... purified using the QIAquick Gel Extraction Kit (Qiagen) and assessed for quality using a Fragment Analyzer (Agilent) ...
-
bioRxiv - Cell Biology 2022Quote: ... The QIAquick PCR Purification Kit (Qiagen cat. #28106) was used to isolate the PCR product following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the QuantiFast SYBR Green PCR Kit (Qiagen). Thermocycling was done for 40 cycles in a two-step cycling in accordance with the manufacturer’s instructions and each PCR reaction was performed in triplicate ...
-
bioRxiv - Microbiology 2024Quote: ... and purified using QIAamp DNA Mini Kit (Qiagen). The purified DNA was tested for purity with a nanophotometer (Implen NP80 ...
-
bioRxiv - Plant Biology 2024Quote: ... and RNA extracted using RNeasy Mini Kit (Qiagen). Number of biological replicates per library ranged between RNA quality was assessed using Tape station High Sensitivity RNA assay (Agilent) ...
-
bioRxiv - Cell Biology 2024Quote: ... and RNA was extracted using RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and concentrated using a PCR purification kit (Qiagen). 3 µl of 10 µM stock tracRNA (IDT ...
-
bioRxiv - Cancer Biology 2024Quote: ... and RNA was extracted using RNeasy Kits (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNeasy Mini Kit was from Qiagen (Germantown, MD). Permafluor ...
-
bioRxiv - Neuroscience 2024Quote: ... using the QuantiTect Reverse Transcription kit (205311, Qiagen). DNA templates were amplified with the following PCR primers ...
-
bioRxiv - Genetics 2024Quote: ... RNA was extracted with RNeasy mini kit (Qiagen) followed by reverse transcription using the Fastquant RT kit (Tiangen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted using the RNeasy Kit (Qiagen); library generation and subsequent sequencing was performed by the clinical genomics lab (CGL ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by the Qiaprep Spin Miniprep Kit (Qiagen). Genomic DNA was isolated via the GeneJet Genomic DNA Purification Kit (Thermo Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... and purified using QIAquick PCR Purification Kit (QIAGEN). The quality and concentration of the linearized plasmid were confirmed via gel-electrophoresis and Nanodrop Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... For cRNA purification the RNeasy Mini Kit (QIAGEN) was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA isolated using RNeasy Mini Kit (Qiagen) and used for RNA sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted using an Rneasy Kit (Qiagen), and reverse-transcribed with the Lunascript Reverse Transcription kit (New England Biolab ...
-
bioRxiv - Cancer Biology 2024Quote: Standard protocols from the miRNeasy Mini kit (Qiagen) was used to extract total RNA with the inclusion of on-column genomic DNA digestion step using the RNase-free DNase Kit (Qaigen) ...
-
bioRxiv - Cell Biology 2024Quote: RNA was extracted using RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: RNAs were extracted with RNAeasy mini kit (Qiagen) including DNase treatment ...
-
bioRxiv - Microbiology 2024Quote: ... was extracted with DNeasy PowerLyzer Microbial Kit (QIAGEN) to assess if the contamination was present in the original samples ...
-
bioRxiv - Neuroscience 2024Quote: ... mRNA was isolated using RNeasy Mini Kit (Qiagen) and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the miRCURY LNA RT Kit (Qiagen, UK) was used to conduct qPCR in the Roche ® LightCycler® 480 according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Viral RNA extraction (QiaAmp Viral RNA kit, Qiagen) was performed using a 140 μL volume of each nasal lavage sample or virus stock ...
-
bioRxiv - Microbiology 2023Quote: ... Following PCR purification (Qiagen QiaQuick PCR Purification Kit), cDNA was processed at the ENPRC core for sequencing on an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Microbiology 2023Quote: Viral RNA extraction (QiaAmp Viral RNA kit, Qiagen) was performed using a 140 μL volume of each nasal lavage sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified by Plasmid Maxi Kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Fecal DNA was extracted using PowerFecal kits (Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the RNeasy Mini kit (Qiagen). A sample for microinjection was prepared by mixing two guide RNAs in water (25 ng/μl for each ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNAs were extracted using RNeasy Mini Kit (Qiagen) and infection confirmed using RT-qPCR quantification of viral RNAs using specific primers pairs ...
-
bioRxiv - Pathology 2024Quote: ... and the miRNeasy Mini Kit (Qiagen; CA; USA). Total amount of isolated RNA was retrotranscribed using the MultiScribe Reverse Transcriptase kit 8 Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen). Residual DNA was removed using RNAse-Free DNase Set (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNeasy® Plus Universal Mini Kit (Qiagen, Germany) was used to extract the total RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The DNA isolation kit (Qiagen DNeasy, Hilden, Germany) was used to isolate sperm genomic DNA according to the manufacture’s protocol ...