Labshake search
Citations for Qiagen :
251 - 300 of 2180 citations for Human IgM Anti Dengue Virus NS1 Serotype 1 Antibody OB4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Total Nucleic Acid (TNA) was extracted using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). RNA isolation and library preparation is fully described in Butler ...
-
bioRxiv - Immunology 2022Quote: ... we isolated viral RNA directly from the Fluenz Tetra vaccine (AstraZeneca; season 2017/2018) virus using the Qiagen Viral RNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cells were cultured in growth media containing virus for 60 hours and total RNA was then extracted with the RNeasy kit (Qiagen). From the total RNA ...
-
bioRxiv - Microbiology 2024Quote: 200µL of lung of infectious cell supernatant (virus stock and HAE) was inactivated with an equal volume of VXL lysis buffer (Qiagen) and viral RNA was extracted using an EZ1 Advanced XL robot with the EZ1 mini virus 2.0 kit (both from Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription quantitative PCR (RT-qPCR) assays were performed with the QuantiTect Virus + ROX Vial Kit (Qiagen, Toronto, ON, Canada) in a LightCycler® 480 system (Roche Molecular System) ...
-
bioRxiv - Microbiology 2023Quote: Total genomic DNA from the bacteriophages and bacterial isolates was extracted using QIAamp UltraSens Virus kit (Qiagen catalog number 53706) and DNeasy Blood & Tissue Kit (Qiagen catalog number 69504 ...
-
bioRxiv - Systems Biology 2023Quote: Viral RNA was extracted from specimens using the QIAamp Viral RNA Minikit and the QIAamp 96 Virus QIAcube HT Kit (Qiagen). Viral transport media (VTM)-only controls were included in each extraction ...
-
bioRxiv - Microbiology 2023Quote: DNase/RNase treated VLPs were used for genomic DNA extraction using Qiagen QIAamp DSP Virus Spin Kit (Qiagen, MD, U.S.A) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acids were extracted from 140 µl of each sample and also from the original virus dilutions with the “QIamp viral RNA extraction kit” (Qiagen) and eluted in 60 µl elution buffer according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... A single colony was picked with an inoculation loop and DNA extraction was performed on the QIAsymphony using the DSP Virus/Pathogen Mini Kit (Qiagen). Library preparation performed using Nextera XT (Illumina Inc. ...
-
bioRxiv - Microbiology 2024Quote: Total genomic DNA from the phage PL and bacterial isolates were extracted using QIAamp UltraSens Virus kit (Qiagen catalog# 53706) and DNeasy Blood & Tissue Kit (Qiagen catalog# 69504 ...
-
bioRxiv - Microbiology 2024Quote: Nucleic acid (NA) extraction was performed in 190 µl from each sample using the QIAamp MinElute Virus Spin Kit (Qiagen). Prior to NA extraction samples were subjected to an enzymatic cocktail treatment composed of 10X DNase 1 buffer ...
-
bioRxiv - Immunology 2024Quote: RNA was isolated from supernatants collected during swab dissociation using the QIAamp MinElute Virus Spin Kit (QIAGEN Cat. No. 57704) for RNA extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... Hepatitis B virus was extracted from fine needle aspirates or whole blood using the DNeasy blood and tissue kit (Qiagen). cDNA from clinical samples (Table S2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Cancer Biology 2021Quote: ... The expression of the BCL-2 anti-apoptotic genes in the NPC cell lines were accessed using the custom RT2 Human Apoptosis Profiler PCR array (Qiagen, Hilden, Germany). To delineate the contribution of MCL-1 for cell survival ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... mAb anti-His6 (34650; IF: 1/500) from Qiagen, mAb anti-GAPDH (GTX28245 ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2021Quote: ... To generate a recombinant A_NS237 virus, viral RNA was extracted from allantoic fluid using Trizol reagent (Thermo Fischer, Germany) and Qiagen RNeasy Kit (Qiagen, Germany) following the manufacturers’ guidelines ...
-
bioRxiv - Genomics 2020Quote: ... Viral RNA was extracted from 300 µl of viral transport media (VTM, Himedia, India) using QIAamp 96 Virus QIAcube HT Kit (Qiagen, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: A 200 μL aliquot of Copan UTM® was processed through the QIAsymphony DSP Virus/Pathogen Mini Kit (Qiagen, Cat# 937036) following manufacturer’s instructions on the QIAsymphony SP instrument ...
-
bioRxiv - Molecular Biology 2020Quote: The RNA isolation was performed with 50 µl of the crude extract on the QIAsymphony with the DSP Virus/Pathogen Kit (Qiagen, #937055). The RT-PCR was performed using 5 µl of 85 µl eluate with TIB MolBiol Lightmix® MODULAR SARS AND WUHAN CoV E-Gene Kit ...
-
bioRxiv - Genomics 2020Quote: Viral RNA was extracted from nasopharyngeal swabs of patients with COVID-19 using the EZ1 DSP Virus Kit (Qiagen, Hilden, Germany), optimized for viral and bacterial nucleic acids extractions from human specimens using magnetic bead technology ...
-
bioRxiv - Microbiology 2021Quote: ... we collected the cell culture supernatants after 24 h of infection for viral RNA extraction with a QIAamp 96 Virus QIAcube HT Kit (Qiagen, 57731) and for viral RNA copy number detection in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from the lungs of influenza virus-infected mice using the RNeasy Mini Kit (QIAGEN, Cat. No 74004) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The followed antibodies and dilutions were used: Strep 1:1000 (Qiagen, 34850), PAF1 1:1000 (Bethyl Labs #A300-173A) ...
-
bioRxiv - Biophysics 2020Quote: ... the surface was incubated with 1 nM biotinylated penta-His antibody (Qiagen) in buffer A for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed overnight using a mouse monoclonal anti-StrepII antibody (Qiagen catalog number 34850) at a 1:2500-1:5000 dilution or a rabbit polyclonal antiserum raised against the PlpD C-terminal peptide NH2-EWLTRVQLGDRQELYSEFYQC-COOH at a 1:5000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... viral RNA was extracted from the egg-isolate of the virus from the nasal swab using the QIAmp viral RNA mini-kit without the addition of carrier RNA (Qiagen, Manchester, UK). cDNA was synthesized from RNA using a random hexamer primer mix and cDNA Synthesis System (Roche ...
-
Host transcriptomic profiling of COVID-19 patients with mild, moderate, and severe clinical outcomesbioRxiv - Genomics 2020Quote: RNA was extracted from nasopharyngeal swabs using the QIAamp Viral RNA Mini or the 213 EZ1 DSP Virus Kits (Qiagen, Hilden, Germany). All patients in this study tested positive for SARS-CoV-2 by RT-qPCR performed at Dubai Health Authority Hospitals ...
-
bioRxiv - Molecular Biology 2020Quote: ... The entire 200-µL reaction was used as input for ssAAV gDNA extraction using a MinElute Virus Spin Kit (Qiagen Cat#57704). 50-ng of ssDNA from each sample were bisulfite converted using the EZ Methylation Gold kit (Zymo Cat#D5005 ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was extracted from virus library and ferret nasal wash samples using the QIAamp® Viral RNA mini kit (Qiagen, Germany). Next generation sequencing was carried out twice on the nasal washes ...
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 RNA was purified using the QIAamp 96 virus QIAcube HT Kit and processed on the QIAcube robotic extraction platform (QIAgen, Hilden, Germany)
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Immunology 2019Quote: ... RNA was isolated from plasma samples using the QIAsymphony Virus/Bacteria Midi kit on the QIAsymphony SP automated sample preparation platform (Qiagen, Hilden, Germany). RNA was extracted manually if plasma volumes were limited ...
-
bioRxiv - Genomics 2020Quote: All 49 COVID-19 patients tested positive for SARS-CoV-2 by RT-qPCR using RNA extracted from nasopharyngeal swabs following the QIAamp Viral RNA Mini or the EZ1 DSP Virus Kits (Qiagen, Hilden, Germany). RNA libraries from all samples were then prepared for shotgun transcriptomic sequencing using the TruSeq Stranded Total RNA Library kit from Illumina (San Diego ...
-
bioRxiv - Immunology 2021Quote: ... Viral RNA was extracted from 200 ul of oral swab material using the Qiagen EZ1 DSP Virus kit on the automated EZ1 XL Advance instrument (Qiagen, Valencia, CA). Real-time quantitative reverse transcription – polymerase chain reactions (RT-qPCR ...