Labshake search
Citations for Qiagen :
101 - 150 of 2078 citations for Human IgM Anti Dengue Virus NS1 Serotype 1 Antibody OB4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... Anti-Penta-His antibody was purchased from Qiagen (Germany).
-
bioRxiv - Biophysics 2023Quote: ... The antibodies were anti-RGSHis (Qiagen, Cat. No. 34650) and peroxidase-conjugated anti-mouse antibody (Dako ...
-
bioRxiv - Biochemistry 2022Quote: ... an anti GAPDH monoclonal antibody (SC-47724) or an anti RGS HIS6 HRP (QIAGEN). When necessary ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Microbiology 2023Quote: ... and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000, Qiagen) as primary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA from these samples was obtained with the QIAamp Mini Elute Virus Spin Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 2 μl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was extracted from each sample using QIAgen DSP virus/pathogen Midi kits (QIAGEN) on a QIASymphonyXP laboratory automation instrument platform ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from 200 μL of specimen using the EZ1 DSP Virus kit (Qiagen) on the EZ1 Advanced XL instrument (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: Tissue homogenates for virus titration were generated using the Tissue Lyzer II (Qiagen, Gaithersburg, MD). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). qRT-PCR was then performed using AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... viral RNA was extracted from virus stocks using the Qiagen Viral RNA Mini Kit (Qiagen) and was used as a template for multi-segment RT PCR as described previously (31) ...
-
bioRxiv - Genomics 2022Quote: ... Viral nucleic acids were then isolated using QIAamp MinElute Virus Spin Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions with some modifications described (Cosentino et al. ...
-
bioRxiv - Microbiology 2023Quote: ... Samples for analysis of virus attachment were directly collected by incubating in RLT buffer (Qiagen) for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and nucleic acid was extracted using EZ1 Advanced XL extraction with a Virus Card (QIAGEN). Six of the 20 FACS populations did not generate sufficient DNA and were not subsequently sequenced ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extraction was performed on the QIAsymphony using the DSP Virus/Pathogen Mini Kit (Qiagen). Library preparation performed using Nextera XT (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: Viral genomic RNA was isolated from concentrated virus stocks with viral RNA isolation kit (Qiagen). RNA was treated with Turbo DNase and inactivation beads (Ambion) ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen, Toronto, ON, Canada). Then ...
-
bioRxiv - Immunology 2020Quote: ... A total of 78 serum samples (positive for HEV IgM in ELISA) were subjected to RNA extraction using QIAamp Viral RNA Mini Kit (Qiagen, Germany). Using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Microbiology 2022Quote: ... After incubation with the primary antibody from QIAGEN (Penta-His Antibody, 1:1000 dilution) at RT for 1 h under shaking ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... Memorial Sloan Kettering Cancer Center) at a dilution of 1:5,000) and His (mouse anti-penta-His antibody (Qiagen, cat. #34660) at a dilution of 1:10,000 ...
-
bioRxiv - Biochemistry 2022Quote: ... Penta-His Antibody (Qiagen, 34660, IB: 1:1000) and Y188 to APP C-terminus (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-Strep-tag II epitope mouse monoclonal antibody # 34850 (QIAGEN), anti-6xHis-tag mouse monoclonal antibody # H1029 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... were functionalized with biotinylated anti-5His antibodies (Qiagen, Valencia CA) and stored with continuous rotation at 4°C in BRB80 (80 mM PIPES ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: anti-STrEP-Tag (#34850, Qiagen), monoclonal anti-β-actin antibody (A5441 ...
-
bioRxiv - Microbiology 2020Quote: ... Viral DNA and RNA were extracted with the QIAamp MiniElute Virus Spin Kit (QIAGEN, Chatsworth, CA) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Real-time one-step reverse transcription quantitative PCR was performed with the QuantiTect Virus Kit (Qiagen, Foster City ...
-
bioRxiv - Bioengineering 2022Quote: RNA was extracted from supernatant culture media using the QIAamp 96 Virus QIAcube HT Kit (Qiagen). E-gene expression was determined using the SensiFAST Probe No-Rox One Step Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... viral RNA was extracted from apical washes using the QIAamp 96 Virus QIAcube HT Kit (QIAGEN). The SARS-CoV-2 genome was amplified using a highly multiplexed tiling PCR reaction based on the ARTIC protocol (https://www.protocols.io/view/ncov-2019-sequencing-protocol-bbmuik6w ...
-
bioRxiv - Microbiology 2020Quote: ... virus medium was aspirated and cells were harvested using 400 µL of RNAprotect Cell Reagent (Qiagen). RNA was extracted using the Qiagen RNAeasy Mini kit ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA of rescued virus strains was extracted with QIAmp DSP viral RNA mini kit (Qiagen), reverse transcribed and amplified with OneTaq one-step RT-PCR kit (NEB ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... RNAs were extracted from each amplified single virus using the QIAamp Viral RNA Mini Kit (Qiagen). Each gene segment was synthesized by gene specific primers (primers available upon request ...
-
bioRxiv - Microbiology 2020Quote: ... using a QIAamp Mini Elute Virus spin kit for the viral RNA/DNA extraction (QIAGEN, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using a QIAamp Mini Elute Virus spin kit for the viral RNA/DNA extraction (QIAGEN, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Qiasymphony automated platform was used to isolate total cellular RNA (DSP virus/pathogen mini kit (Qiagen). RNA was further processed in an in-house assay using primers of previously validated assays (44 ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from the virus sample with a QIAamp Viral RNA mini kit (QIAGEN). SARS-CoV-2 RdRP-2 gene primer probes sequences are as follows ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from each sample using the QIAamp MinElute Virus Spin Kit (Qiagen, Hilden, Germany), and a semi-nested PCR assays was used for the detection of viral nucleic acids in each sample ...
-
bioRxiv - Genomics 2021Quote: ... Remaining 140 µL of concentrated virus was processed according to QIAamp Viral RNA Mini kit (QIAGEN) protocol ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids were extracted from specimens using QIAamp 96 Virus QIAcube HT Kit (Qiagen, Hilden, Germany), QIAamp Viral RNA Mini Kit (Qiagen) ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: Total DNA was extracted from tissues using QIAamp MinElute Virus Spin Kit (57704, Qiagen, Venlo, Netherlands) or KingFisher Cell and Tissue DNA kit (97030196 ...
-
bioRxiv - Microbiology 2024Quote: ... following the manufacturer’s protocol for the QIAamp MinElute Virus Spin Kit (Cat. 57704, Qiagen, Hilden, Alemania). The resulting DNA for each sample was quantified with a Qubit fluorometer (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked with 5% milk in PBST (Phosphate buffer saline, 0.05% Tween 20) and incubated with monoclonal mouse anti-His antibody (Penta His, Qiagen, dilution 1:1000) according to the manufacturers’ instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... For the detection of phosphorylated Serine residues a TBS solution with a 1:100 dilution of the Anti-Phospho-Serin Antibody (Qiagen, Hilden, Germany) was used ...