Labshake search
Citations for Qiagen :
251 - 300 of 10000+ citations for Fumarase from porcine heart since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Ni-NTA agarose resin from Qiagen. [3′-2H]GTP was enzymatically synthesized by Dr ...
-
bioRxiv - Physiology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Microbiology 2021Quote: IMAC beads (Ni-NTA from Qiagen) were prepared by washing 3× with HPLC water ...
-
bioRxiv - Pathology 2021Quote: ... MEKK3 siRNA were purchased from QIAGEN (Hs_MAP3K3_5 ...
-
bioRxiv - Immunology 2020Quote: ... The RNeasy kit was from Qiagen. All reagents were titered and used according to the manufacturers’ recommendations.
-
bioRxiv - Biochemistry 2020Quote: ... from the RNeasy Mini Kit (Qiagen) and lysates were stored at −80°C ...
-
bioRxiv - Immunology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Cell Biology 2021Quote: ... All primers were purchased from Qiagen website ...
-
bioRxiv - Synthetic Biology 2021Quote: ... miRNA inhibitors were purchased from Qiagen as miRCURY LNA miRNA inhibitors ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control siRNA (1027281) was from Qiagen, rat SUN1 (gene ID:360773 ...
-
bioRxiv - Cell Biology 2021Quote: ... negative control: AllStars negative control from Qiagen) using Interferin transfection reagent (Polyplus transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Effectene Transfection Reagent (301427) from Qiagen. Lipofectamine RNAiMAX Reagent (100014472 ...
-
bioRxiv - Molecular Biology 2021Quote: ... si53BP1 (SI01456539) were purchased from Qiagen. ON-target Human siPOGZ (L-006953-01-0005 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The following primer sets from Qiagen were used ...
-
bioRxiv - Cell Biology 2020Quote: RNeasy Mini Kit was from Qiagen. Polyethyleneimine (PEI ...
-
bioRxiv - Cell Biology 2021Quote: ... FlexiTube siRNA were obtained from Qiagen: SLK#1 (SI00107723) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control siRNA (1027281) was from Qiagen, On-target plus human Notch1 siRNA smartpool was from Dharmacon (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The U6 snRNA primer from Qiagen was used for normalization ...
-
bioRxiv - Microbiology 2023Quote: ... DNA isolation kits were from QIAGEN and MACHEREY-NAGEL ...
-
bioRxiv - Developmental Biology 2023Quote: ... ilp8 primers used from Qiagen (QT00510552), dmyc forward primer (AACGATATGGTGGACGATGG) ...
-
bioRxiv - Cell Biology 2023Quote: ... both from Qiagen (German-town, MD). Fission yeast genomic DNA was prepared using YeaStar Genomic DNA Kit from Zymo Research (Irvine ...
-
bioRxiv - Molecular Biology 2022Quote: ... Gapmer ASOs were obtained from Qiagen. Sequences and chemistry information for all oligonucleotides can be found in Supplementary Data 3.
-
bioRxiv - Cancer Biology 2024Quote: ... respectively (both from Qiagen, Germantown, MD) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Validated primers were obtained from Qiagen, UK for the miRNAs ...
-
bioRxiv - Genetics 2024Quote: ... using a RNeasy kit from QIAGEN. Quality and concentration or the RNA samples was assessed through spectrophotometry using a NanoDrop (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCT4 siRNA was purchased from Qiagen (FlexiTube GeneSolution GS9123 for SLC16A3 ...
-
bioRxiv - Immunology 2023Quote: ... Pre-synthesized QuantiTect primers from Qiagen were used for il12b ...
-
bioRxiv - Molecular Biology 2023Quote: ... we purchased commercial primers from Qiagen. Primers for mouse Sprr1a (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2022Quote: ... The siRNAs were purchased from Qiagen and Dharmacon (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... Ni-NTA agarose was from Qiagen or Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Ni-NTA Agarose beads from Qiagen, protein A Sepharose beads from Amersham.
-
bioRxiv - Microbiology 2022Quote: IMAC beads (Ni-NTA from Qiagen) were prepared by washing 3x with HPLC water ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ni-agarose beads were from Qiagen or NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Ni-NTA Agarose from QIAGEN (Germany), Ni-NTA Magnetic Beads from Bioneer (South Korea ...
-
bioRxiv - Cell Biology 2024Quote: ... Ni-NTA agarose from Qiagen (30210), and glutathione Sepharose bead from GE healthcare (GE17-0756-01) ...
-
bioRxiv - Immunology 2024Quote: ... the Rneasy mini kit from Qiagen and DNAse digestion ( TURBO DNA-free™ Kit from Invitrogen™ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The primers were purchased from Qiagen (Catalogue number ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse ATP7A: Primers purchased from Qiagen with Cat # Mm_Atp7a_1_SG QuantiTect Primer Assay (QT00152677 ...
-
bioRxiv - Genetics 2024Quote: ... a DNA extraction kit from Qiagen (DNeasy Blood & Tissue Kits ...
-
bioRxiv - Developmental Biology 2024Quote: ... and Sobp were purchased from Qiagen. All assays were performed in duplicates at least three times ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was coextracted from all samples available using the AllPrep RNA Extraction from FFPE Tissue Kit (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: DNA and RNA was extracted from FFPE PDX tissue using the DNA FFPE Tissue Kit from (Qiagen) and RecoverAll Total Nucleic Acid Isolation kit (Ambion) ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from 50 ml LB from an overnight culture using a plasmid midi kit (Qiagen). Successful genomic DNA extraction was confirmed by PCR with primers gp41 inner F (5’-CAAGAGCAAAGAACCGACG-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: The genomic DNA from clinical FFPE samples was extracted using QIAamp DNA FFPE Tissue Kit from Qiagen and quantified using Qubit from Thermo Fisher Scientific.
-
bioRxiv - Evolutionary Biology 2022Quote: ... We extracted genomic DNA from tissue samples using the MagAttract High Molecular Weight DNA Kit from Qiagen following manufacturer’s instructions (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNAs from neural crest explants from injected embryos were extracted with RNeasy® Micro Kit (Qiagen) and used for relative quantitative PCR (QuantStudio 3 real Time PCR system ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA was extracted from sort-purified cells from 22 patients by QiaAmp DNA micro kit (Qiagen). For reliable identification of expanded clones ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from skin biopsies (~1 cm2) taken from the upper backs of mice (Qiagen #74106). Each RNA sample was collected in 40 μL of ultrapure water (Thermo Fisher #10977) ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Cancer Biology 2022Quote: ... genomic DNA was extracted from cell pellets from CRISPR or base editing screens (DNeasy Blood & Tissue; Qiagen), gRNA DNA sequences were PCR amplified (empirically determined number of cycles ...