Labshake search
Citations for Qiagen :
251 - 300 of 1940 citations for 6 chloro 2 mercaptoquinazolin 4 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: RT-PCR was performed on the extracted RNA with One-Step RT-PCR kit (Qiagen, #210212) according to the manufacturer’s instructions and the following conditions ...
-
bioRxiv - Genomics 2023Quote: ... which were merged into one assembly using CLC-Bio Genomics Workbench De Novo Assembly (Qiagen, v11.0.1) with default parameters ...
-
bioRxiv - Genomics 2023Quote: ... and the BioSprint 96 one-for-all Vet Kit utilizing ASL buffer (19082; Qiagen, Germantown, MD) and bead beating ...
-
bioRxiv - Cancer Biology 2023Quote: ... genomic libraries were constructed from adductor muscle DNA from one individual cockle (DNeasy Tissue Kit, Qiagen), from Deep Bay ...
-
bioRxiv - Microbiology 2024Quote: ... One µg of purified RNA was treated twice with 5 µl of RNAse-free DNAse (Qiagen) and subjected to a final on column purification ...
-
bioRxiv - Immunology 2024Quote: ... One μg of RNA was reverse-transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) containing both oligo-dT and random primers.
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 6 and 9 hours of treatment using RNeasy Plus Mini Kit (Qiagen, 74134), and was reverse-transcribed to cDNA using Transcriptor First Strand cDNA Synthesis Kit with random primers (Roche ...
-
bioRxiv - Genetics 2019Quote: Raw sequence files (FASTQ) were imported into CLC Genomics Workbench (v.6; Qiagen) and mapped onto the human genome (GRCh37/hg19) ...
-
bioRxiv - Biophysics 2020Quote: ... The studies were carried out on a Rotor-Gene Q 6 plex (QIAGEN) instrument at a heating rate of 2 °C/min and a temperature range of 25-90 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 6 dpf larvae (RNeasy Plus Mini Kit; Qiagen) and reversed transcribed (iScript Reverse Transcription Supermix ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RPR2 (n=6) primary tumors was performed using RNeasy Mini Kit (Qiagen) with the standard protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The 6 PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) to eliminate byproducts.
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 6-well plates using miRNeasy Mini Kits (QIAGEN 217004) with the inclusion of an on-column DNase digestion (QIAGEN 79254) ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Plant Biology 2019Quote: ... corm (two independent replicates) and rootlets (one replicate) was extracted with the RNeasy plant mini kit (Qiagen). On-column DNase I treatment was performed with RNase-free DNase I (Qiagen) ...
-
bioRxiv - Physiology 2020Quote: ... mixed with one volume of 70% ethanol and applied directly to an RNeasy Mini Kit column (Qiagen). DNAse treatment on the column and total RNA recovery were performed as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: One µg of DNA was bisulfite-treated using the EpiTect® 96 Bisulfite Kit (Qiagen, Hilden, Germany) and analysed using the Infinium Human Methylation 450K BeadChips (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Viral genomic RNA (gRNA) was detected with a one-step real-time RT-PCR assay (Quantifast, Qiagen) using primers and probes generated to target either the SARS-CoV-2 E (28 ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-PCR was carried out using the QuantiTect probe RT-PCR kit (Qiagen, Valencia, CA) with 500 nM forward and reverse primers and 50 nM labeled probes (DENV2-FAM and ZIKV-FAM and PGK1-VIC TaqMan) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from one-week-old Arabidopsis seedlings using the RNeasy Plant Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... One third of specimens were extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA), while later extractions used a CTAB/PCI extraction approach (Chen et al. ...
-
bioRxiv - Genomics 2022Quote: ... bacterial pellets were pooled into one tube and DNA extracted with the Gentra Puregene tissue kit (Qiagen) with resuspension of the DNA pellet in 100 µl of nuclease-free water.
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of RNA was reverse transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen). The template amount of 6.6 ng RNA equivalent per wellt was used and the PCR reaction was performed in triplicate using the total volume of 8 µl in 384 well plate format ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA were extracted from approximately one million to two million cells using RNeasy Mini Kit (QIAGEN) according to the recommendation of manufacturer and then NEBNext® Poly (A ...
-
bioRxiv - Microbiology 2021Quote: ... RORC1 and RORC2 gene expression was evaluated by One step SYBR green real-rime RT-PCR (Qiagen) using a Light-Cycler 480 II as follows ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA was extracted from one or two leaves of each individual using the DNeasy Plant kit (QIAgen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (QIAGEN, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... One section was added to a MACs M tube (Miltenyi Biotech, U.K.) containing 1ml Qiazol (Qiagen, U.K.) and dissociated on a GentleMACs (Miltenyi Biotech ...
-
bioRxiv - Immunology 2020Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR Kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT Mix ...
-
bioRxiv - Immunology 2020Quote: ... Extraction of these samples was performed using the BioSprint™96 One-For-All vet kit (Qiagen) and Kingfisher Flex platform as per manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... or 500 ng of total RNA for reverse transcription using the One Step RT PCR-Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT mix ...
-
bioRxiv - Neuroscience 2023Quote: ... VG and DRG were transferred into an 1.5ml tube containing one Tungsten Carbide bead (3mm, Qiagen, #69997) and 1 mL of Qiazol lysis reagent (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: RNA was isolated from one quarter of a mouse kidney using RNeasy Plus Mini Kit (Qiagen, 74134). For quantitative real-time PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from one haploid male at emergence using the MagAttract® HMW DNA Kit (Qiagen). The male wasp tissues were disrupted in a 2 mL tube containing 200 µL of 1X DPBS ...
-
bioRxiv - Zoology 2023Quote: Genomic DNA was extracted from one specimen using the Dneasy Blood & Tissue kit (Qiagen, Valencia, CA, USA), following the manufacturer’s instructions but with the initial proteinase K lysis step extended to 16 hours at 56°C with continuous agitation.
-
bioRxiv - Microbiology 2023Quote: ... with extraction performed as is the protocol for the BioSprint 96 One-For-All Vet Kit (Qiagen). Every eleventh of twelve wells in a 96-well plate was a blank DNA extraction control (seven in total ...
-
bioRxiv - Microbiology 2023Quote: ... We pooled the samples into one and purified them using the MinElute PCR Purification Kit (QIAGEN, Germany). The products were quantified using a Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...