Labshake search
Citations for Qiagen :
201 - 250 of 1940 citations for 6 chloro 2 mercaptoquinazolin 4 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... One fifth of the cells was used for plasmid DNA extraction (Qiagen, Hilden, Germany). The remaining cells underwent RNA extraction using the innuPREP RNA Mini Kit 2.0 (Analytik Jena ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was prepared from cells harvested one day post-transfection (RNeasy mini kit, Qiagen) and used for cDNA synthesis (iScript cDNA synthesis kit ...
-
bioRxiv - Microbiology 2023Quote: Lungs were collected in 500 µL of DPBS containing one stainless steel bead (QIAGEN), homogenized with the Tissue-Lyser II (QIAGEN) ...
-
bioRxiv - Plant Biology 2024Quote: ... One microgram was treated with DNase and reverse transcribed using the Quantitect kit (Qiagen) following the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... One µg of RNA was reverse transcribed using the miRScript II kit (218161; Qiagen) or miRCURY LNA RT Kit (339340 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Cell Biology 2019Quote: ... 10μL volume PCR assays were conducted using Quantifast One Step RT-PCR kit (Qiagen, UK) on a ViiA7™ Real-Time PCR System (Applied bio-systems ...
-
bioRxiv - Microbiology 2020Quote: ... Seven overlapping RT-PCR fragments were generated with the One-Step RT-PCR Kit (Qiagen) and purified using the Zymoclean Large Fragment DNA Recovery kit (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified by one-step qRT-PCR using QuantiFast Probe PCR reagents (Qiagen) and primers and probes specific for the SARS-CoV2 sub-genomic E RNA as previously described (Corman et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and analysed using a one-step RT-PCR (PCR with reverse transcription) kit from Qiagen, both using the standard protocol ...
-
bioRxiv - Developmental Biology 2022Quote: RNA from one million cells was isolated using the RNeasy plus mini kit (Qiagen #74134). 5μg of RNA was subjected to ribosomal and mitochondrial RNA depletion using the RiboZero Gold kit (Human/Mouse/Rat ...
-
bioRxiv - Microbiology 2022Quote: ... One-step RT-qPCR was performed with QuantiFast Probe RT-PCR+ROX Vial Kit (Qiagen) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... One μg total RNA was used for cDNA synthesis using Quantinova Reverse Transcription kit (Qiagen). Real time PCR was performed in an ABI Prism 7500 (Applied Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... Gel-based RT-PCR analyses were performed using the One-Step RT-PCR kit (Qiagen) in a final volume of 10 µL starting from 0.03 µg of DNase- treated (RQ1 Rnase-free Dnase supplemented with Rnasin Ribonuclease Inhibitor ...
-
bioRxiv - Neuroscience 2024Quote: ... CeA tissue was prepared for homogenization by placing one stainless steel bead (5mm) (Qiagen, PN69989) inside the tube ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2020Quote: ... one well per condition was harvested and processed using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s instructions as noted above ...
-
bioRxiv - Molecular Biology 2019Quote: Real-time one-step reverse transcription quantitative PCR was performed with the QuantiTect Virus Kit (Qiagen, Foster City ...
-
bioRxiv - Neuroscience 2022Quote: Total RNAs (small and large RNAs) were extracted in one fraction with miRNeasy FFPE kit (Qiagen) following manufacturer’s protocol with minor changes ...
-
bioRxiv - Cancer Biology 2020Quote: An RNA probe targeting c-myb was generated using one-step RT-PCR (Qiagen, Manchester, UK) using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was isolated from NIH3T3 cells using the FastLane Cell One-Step Buffer Set (Qiagen). The mouse embryo brains at E10.5 were dissected in cold PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... One fifth of the total sample was used to purify RNA using miRNeasy kit (QIAGEN, 217004) and to calculate RNA enrichment ...
-
bioRxiv - Physiology 2022Quote: Approximately one-half of the powdered brain was homogenized in 1ml of QIAzol lysis reagent (Qiagen) and RNA was isolated using the Direct-zol RNA Miniprep Plus Kit (Zymo Research) ...
-
bioRxiv - Biochemistry 2022Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 µM each XBP1 specific primers and one-step RT-PCR (QIAGEN OneStep RT-PCR, 210212). The PCR products were analysed by 2% agarose gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... One microgram of DNA was bisulfite-treated using the EpiTect 96 Bisulfite Kit (Qiagen GmbH, Germany). 200 ng of bisulfite-treated DNA was analysed using Infinium HumanMethylation 450K BeadChips (Illumina Inc. ...
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted from leaves of one to two plants using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Microbiology 2020Quote: ... CDNA fragments were amplified with strain-specific primers using the one step RT-PCR kit (Qiagen). Sequencing was performed by Macrogen Europe ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from one retina per fish using RNeasy Lipid/Tissue Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... One microgram of purified RNA was converted into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... One µg of genomic DNA was used for bisulfite conversion by using EpiTect Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... we extracted DNA from fresh tissue from one individual using the MagAttract HMW DNA Kit (Qiagen). Prior to library preparation ...
-
bioRxiv - Microbiology 2021Quote: ... All reactions were set up in triplicate using a One-Step RT-PCR kit (Qiagen, UK) as per the following run conditions ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was isolated from one HIP hemisphere by DNeasy Blood & Tissue Kit (Qiagen, catalog # 69504), the DNA quality was first confirmed by Nanodrop (ThermoFisher ...
-
bioRxiv - Genetics 2019Quote: One microgram of total RNA was reverse-transcribed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen). As a control for genomic DNA contamination ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from one cerebellar hemisphere using the Qiagen miRNeasy Mini kit (Qiagen #217004). On column DNAse digestion (Qiagen #79254 ...