Labshake search
Citations for Qiagen :
201 - 250 of 5856 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... PCR reactions were set-up using the complementary QIAgility robotic pipettor (Qiagen) to ensure maximum pipetting accuracy ...
-
bioRxiv - Genetics 2020Quote: RT-qPCR was performed using the 2x QuantiTect Probe RT-PCR kit (Qiagen, Valencia, CA, USA) with the same primers and cycle times as previously described[53] ...
-
bioRxiv - Cancer Biology 2020Quote: ... Q-RT-PCR was conducted using the miScript SYBR Green PCR Kit (218073, Qiagen) as indicated by the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-PCR for specific miRNAs was performed using miRCURY LNA miRNA PCR Kit (Qiagen) following the manufacturer’s protocol (miRCURY LNA miRNA PCR-Exosomes ...
-
bioRxiv - Microbiology 2021Quote: ... each 25 µl PCR reaction comprised 1x OneStep Ahead RT-PCR master mix (Qiagen), 1x OneStep Ahead RT mix (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The first round of PCR was performed using the OneStep RT-PCR Kit (Qiagen) with primer pair AK4340F1 and AK4630R1 (Kapoor et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed using the QuantiTect SYBR Green RT-PCR Kit (Qiagen, Germany). The gene-specific primers capable of amplifying 150-250 bp region from all the three homoeologous of two TaVIH genes were carefully designed using Oligocalc software ...
-
bioRxiv - Cell Biology 2023Quote: ... For real-time quantitative PCR (RT-qPCR) QuantiTect SYBR Green PCR Kit (Qiagen, 204145) and the LightCycler 480 system II from Roche were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unincorporated primers were removed using QIAquick PCR Purification Kit (Qiagen) and eluted twice with 30 µl of water ...
-
bioRxiv - Neuroscience 2023Quote: ... custom LNA PCR primers were designed and synthesized by Qiagen for hsa-tRF-Glu-CTC (5’-TCCCTGGTGGTCTAGTGGTTAGGATTCGGCG –3’) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative PCR was performed with SYBR green PCR mix (primers for SAMD1 from QIAGEN N.V.) and analysis performed with StepOne Software (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... using miRCURY LNA SYBR Green PCR Master Mix and miRCURY LNA miRNA PCR primers (Qiagen). All protocols were performed according to the manufacturers’ instructions ...
-
bioRxiv - Pathology 2021Quote: ... Quantitative PCR was performed with SYBR green PCR mix (primers for SAMD from QIAGEN N.V.) and analysis performed with StepOne Software (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: Error-prone PCR was performed to make a few amino acid substitutions in the scFv region using psfGFP-N1-2E12 as a template and a set of primers (scFv primer_s and scFv primer_as) with Taq DNA Polymerase (QIAGEN) in the presence of MnCl2 (6 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... using the One Step RT-PCR kit (Qiagen, Hilden, Germany) for RHDV2 ...
-
bioRxiv - Microbiology 2021Quote: ... The one-step QuantiTect SYBR Green RT-PCR kit (Qiagen) was used to synthesize the cDNA and perform qPCR under the following conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... A QuantiFast SYBR Green RT-PCR kit (Qiagen; Hilden, Germany) was used to perform real time PCR on a LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Microbiology 2021Quote: ... and S was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (GENEWIZ) ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA amplification using a OneStep RT-PCR Kit (Qiagen) and segment-specific primers (sequences available upon request) ...
-
bioRxiv - Microbiology 2022Quote: ... using the Qiagen OneStep RT-PCR kit (Qiagen, Hilden, Germany). The conventional RT-PCR was adapted from Bouscambert-Duchamp (Bouscambert-Duchamp et al. ...
-
bioRxiv - Microbiology 2022Quote: ... using the Qiagen OneStep RT-PCR kit (Qiagen, Hilden, Germany), with primers mix Fw 5 ‘-CAATGCAGGTATAACAC.’CAGCAATATC-3’ and Rv 5’-GCAACAATTGAACTGATCTTCAGGAAAC-3’ 50μM each ...
-
bioRxiv - Immunology 2021Quote: ... and S was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (GENEWIZ).
-
bioRxiv - Immunology 2021Quote: ... and S was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (GENEWIZ) ...
-
bioRxiv - Immunology 2022Quote: ... and the QuantiFast Probe RT-PCR +ROX Vial Kit (Qiagen), in the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... and the QIAGEN OneStep RT-PCR Kit (Qiagen, Venlo, Netherlands). Amplicon length and concentration was analysed using HS DNA 1000 with TapeStation 2200 (Agilent ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was performed using miScriptSYBR Green PCR Kit (Qiagen) and commercially available miRNA Primer Assays (Table.S1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT² Profiler™ PCR Array Mouse Neurogenesis (330231, Qiagen, Germany) was performed according to the manufacturer’s instructions on LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... and quantified using QuantiFast SYBR Green RT-PCR Kit (Qiagen) and a CFX96 Touch Real-Time PCR Detection thermocycler (BioRad) ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was performed (QuantiTect SYBR Green PCR Kit, Qiagen) in duplicate ...
-
bioRxiv - Cell Biology 2023Quote: ... A QuantiFast SYBR Green RT-PCR kit (Qiagen; Hilden, Germany) was used to perform real time PCR on a LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Immunology 2024Quote: ... TCRα/β were amplified using OneStep RT-PCR kit (Qiagen) according to the manufacturer recommendation ...
-
bioRxiv - Molecular Biology 2019Quote: ... The probe set was purified using MinElute PCR Purification Kit (Qiagen, cat. #28004) following manufacturers protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 0.5 μl dNTP mix (dNTP Set, PCR Grade, 10mM each, Qiagen, Hilden, Germany), 0.125 μl Taq DNA Polymerase (5 units/L ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primers for qRT-PCR were designed using the Primer Quest tool (Integrated DNA Technologies) and SYBR Green (Qiagen) was used as the DNA intercalating dye ...
-
bioRxiv - Bioengineering 2023Quote: ... Primers for qRT-PCR were designed using the Primer Quest tool (Integrated DNA Technologies) and SYBR Green (Qiagen) was used as the DNA intercalating dye ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real-time quantitative RT-PCR was performed using the miScript SYBR Green PCR kit (Qiagen) and a ViiA 7 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative real-time PCR was performed with a Rotor-Gene Q RT-PCR machine (QIAGEN) using a KAPA SYBR FAST qPCR kit (Kapa Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... 10μL volume PCR assays were conducted using Quantifast One Step RT-PCR kit (Qiagen, UK) on a ViiA7™ Real-Time PCR System (Applied bio-systems ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative RT-PCR (qRT-PCR) experiments were carried out on a Rotor-gene Q (Qiagen) apparatus.
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR gene expression analysis was performed with QuantiFast SYBR Green PCR kit (Qiagen) using a StepOnePlus (Applied Biosystem) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and analysed using a one-step RT-PCR (PCR with reverse transcription) kit from Qiagen, both using the standard protocol ...
-
bioRxiv - Genetics 2022Quote: ... Quantitative RT-PCR was conducted in triplicate using a Quantitect SYBR Green PCR reagent (Qiagen) following manufacturer instructions on a Bio-Rad CFX96 Real-Time PCR system (Bio-Rad ...
-
bioRxiv - Bioengineering 2022Quote: ... Custom RT² Profiler PCR Arrays and SYBR® Green PCR Master Mix (Qiagen, Hilden, Germany) were used to detect expression of transcripts ...
-
bioRxiv - Molecular Biology 2019Quote: ... or gga-miR-429-3p mimics (Qiagen) using 0.65 μL of PolyJet™ (SL100688 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and has-miR-130b-5p (Qiagen, MIMAT0004680) were transiently expressed to induce senescence-like phenotype ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-has-miR-130b-3p (Qiagen, MIMAT0000691) and Ant-has-miR-130b-5p (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR reaction was carried out using the QuantiNova Kit Probe RT-PCR Kit (Qiagen, catalog #208354, Germany), using primers and probe described in Naveca et al ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR was performed using primers listed in Table S3 and QuantiNova SYBR Green PCR (Qiagen) or iTaq™ Universal SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed using SYBR Green QuantiTect Primer Assay (Qiagen) according to manufacturer’s instructions in a 7900HT Fast-Real Time PCR System Instrument (Applied Biosystems ...