Labshake search
Citations for Qiagen :
151 - 200 of 5856 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... and from lung and/or heart tissues of seropositive rodents were used to amplify viral genome by RT- PCR using the One Step RT-PCR kit (QIAGEN) followed by nested or heminested PCRs (Taq Pegasus ...
-
bioRxiv - Immunology 2020Quote: ... The presence of the desired mutations in the viral genomes was verified by sanger sequencing of RT-PCR amplicons generated with the OneStep RT-PCR-kit (Qiagen) using LCMV WE GP-specific primers (GATTGCGCTTTCCTCTAGATC and TCAGCGTCTTTTCCAGATAG) ...
-
bioRxiv - Microbiology 2022Quote: ... villosum) (Table 1) were used in RT-PCR tests conducted in Slovenia using the OneStepTM RT-PCR kit (Qiagen, USA) as previously described (Rivarez et al ...
-
bioRxiv - Molecular Biology 2023Quote: Quantitative RT-PCR was performed using 30 ng of total RNA and QuantiTecT sYBR Green RT-PCR kit (Qiagen, 204243) according to the supplier’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Transcript-specific primers were designed to span introns and the spcar3 mutation site and used in one-step RT-PCR reactions (210210, OneStep RT-PCR kit, Qiagen). Primer sequences for qRT-PCR are listed in Table 1 ...
-
bioRxiv - Pathology 2021Quote: ... the RT-qPCR reaction was prepared using the OneStep RT-PCR kit (Qiagen, Germany), adjusted to a volume of 12.5 µl with an internal control mastermix ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCRs and qPCRs were performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen) respectively with and without RT on a LightCycler 480 (Roche).
-
bioRxiv - Synthetic Biology 2022Quote: ... RT-PCR on the recovered mRNA was performed using the SensiScript RT Kit (Qiagen) with reverse primers that bound the 3’ end of each POI sequence ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR reactions were performed using the OneStep RT-PCR Kit (Qiagen) with only very few differences compared to the detection assay ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesised and PCR amplified with Onestep RT-PCR kit (Qiagen). Ighv alleles were amplified using a common variable region primer msVHE (5’GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG3’ ...
-
bioRxiv - Microbiology 2020Quote: ... using One Step RT-PCR kit (Qiagen, Germany) and its larger portion was amplified for phylogenetic analysis by self designed primers ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was prepared using Quantitect RT- PCR (Qiagen) and RT Q-PCR was performed using the TaqMan Gene Expression Assay (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... QuantiFast SYBR Green RT-PCR Kit (Qiagen, 204156) was used for the qPCR reaction and measurement performed on the 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was prepared using Quantitect RT-PCR (Qiagen) and PCR performed with Brilliant III SYBRGreen on a Stratagene Mx3000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RT² Profiler PCR Array (Qiagen, 330231), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: RT-PCR or PCR products were cleaned up with QIAquick PCR purification kit (28106, QIAGEN) or QIAquick Gel Extraction kit (28706 ...
-
bioRxiv - Microbiology 2020Quote: PCR products obtained by above RT-PCR were purified by QIAquick PCR Purification Kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2022Quote: ... qRT-PCR was performed by QuantiTect SYBR Green PCR using miRNA- specific primers provided as miScript Universal primer and miScript Primer assay (QIAGEN) and Thermal Cycler Dice Real Time System (TAKARA).
-
bioRxiv - Developmental Biology 2021Quote: ... then cDNA synthesized using universal primers in the miRCURY LNA RT Kit (QIAGEN). Expression was quantified by qRT-PCR using the miRCURY LNA SYBR Green PCR Kit (QIAGEN ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by cDNA synthesis using random primers and the Omniscript RT kit (Qiagen). qPCR was performed using the MAXIMA SYBR Green kit (Thermo Scientific ...
-
Global genetic patterns reveal host tropism versus cross-taxon transmission of bat BetacoronavirusesbioRxiv - Evolutionary Biology 2020Quote: ... All RNA extracts were subjected to reverse transcription polymerase chain reaction (RT-PCR) using the one-step RT-PCR kit (Qiagen, USA) and PanCoV F2 (5’-AAR TTY TAY GGH GGY TGG-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Digoxigenin labeled miRCURY LNA probes (HSA-MIR-10B-5P, SCRAMBLE-MIR, miRCURY LNA U6, Qiagen) were diluted in hybridiziation buffer after a denaturation step at 90 °C and incubated on cells for 30 min (60 min tissue sections ...
-
bioRxiv - Molecular Biology 2021Quote: ... Three reactions per sample and per set of primers were prepared and processed using RotoGene (QIAGEN) with standard cycling.
-
bioRxiv - Neuroscience 2021Quote: ... Preamplification on cDNA was performed using the miScript PreAMP kit using the following primer sets (Qiagen): Hs miR146a_1 (M00003535) ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR reactions were set up in triplicates using QuantiFast SYBR Green PCR Kit (Qiagen) and then carried out on the 7500 Real-Time PCR system (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: RT-qPCR was carried out using QuantiTect SYBR® Green RT-PCR Kit (Qiagen, 204243) using the primer pairs detailed in Supplementary Table S11 ...
-
bioRxiv - Microbiology 2022Quote: ... One-step RT-qPCR was performed with QuantiFast Probe RT-PCR+ROX Vial Kit (Qiagen) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers were purified by MinElute PCR Purification Kit (QIAGEN), to do the fusion PCRs ...
-
bioRxiv - Developmental Biology 2022Quote: ... We carried out qRT-PCR for miR-24-3p using the miRCURRY LNA kit as described (Qiagen). The primer sequences used for U6Sn ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR was performed using the QuantiTech SYBR Green RT-PCR kit (Qiagen) per the manufacturer’s instructions ...
-
Integrative analysis of hexaploid wheat roots identifies signature components during iron starvationbioRxiv - Plant Biology 2019Quote: ... qRT-PCR was performed using QuantiTect SYBR Green RT-PCR mastermix (Qiagen, USA) with programs recommended by the manufacturer in the ABI 7700 sequence detector (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-PCR was conducted using QuantiTect SYBR Green PCR Kit (Qiagen; Germantown, MD) in 96 well PCR plates (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative RT-PCR was performed using the RotorGene SyBr Green PCR kit (Qiagen) in a Rotorgene Q PCR cycler under the following amplification conditions ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Real-time PCR was performed with QuantiTect SYBR green RT-PCR kit (Qiagen) in an ABI 7500 Fast system ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-PCR was performed in triplicate using SYBR Green PCR Master Mix (Qiagen) and run on Viia7 platform (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics). The protocol used is described in DOI ...
-
bioRxiv - Cell Biology 2022Quote: ... Dual labeled miRCURY LNA miRNA detection probes of dre-mir-430a-3p and scramble-miR (Qiagen, catalogue no ...
-
bioRxiv - Neuroscience 2022Quote: ... miR-495 pLNA (miRCURY LNA miRNA Power Inhibitor HSA-MIR-495-3P, Qiagen #339130 YI04101229-DCA).
-
bioRxiv - Neuroscience 2022Quote: ... miR-329 pLNA (miRCURY LNA miRNA Power Inhibitor RNO-MIR-329-3P, Qiagen # 339130 YI04101481-DCA), miR-495 pLNA (miRCURY LNA miRNA Power Inhibitor HSA-MIR-495-3P ...
-
bioRxiv - Immunology 2021Quote: ... RT² Profiler PCR Array (QIAGEN, Cat. no. PAMM-021Z) was used ...
-
bioRxiv - Bioengineering 2020Quote: ... using the QuantiTect SYBR Green RT-PCR kit (Qiagen). Cycle conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μl 5x One-step RT-PCR buffer (Qiagen), 10 μl Triton-x100 (0.3%) ...
-
bioRxiv - Bioengineering 2021Quote: ... using the QuantiTect SYBR Green RT-PCR kit (Qiagen). Cycle conditions were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... miRCURY LNA Universal RT microRNA PCR (cat#339306, Qiagen). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... or QuantiNova SYBR Green RT-PCR Kit (Qiagen, MD) per manufacturer’s protocol on a QuantStudio 3 (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Molecular Biology 2019Quote: ... Several rounds of PCR amplification with the PCR Primer Cocktail and PCR Master Mix (Qiagen, Duesseldorf, Germany) were performed to enrich the adapter-ligated DNA fragments ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-miR-221-3p (Qiagen MIN0000278) or non-targeting siRNA (NT ...
-
bioRxiv - Molecular Biology 2023Quote: ... mmu-miR-130b-5p (Qiagen, MSY0004583), has-miR-130b-3p (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... has-miR-130b-3p (Qiagen, MIMAT0000691) and has-miR-130b-5p (Qiagen ...