Labshake search
Citations for Qiagen :
201 - 250 of 2439 citations for WY 45494 hydrochloride CAS 93413 90 2 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNeasy® Plant Mini Kit (Qiagen, Valencia, CA, USA), respectively ...
-
bioRxiv - Genetics 2021Quote: ... followed by purification with RNeasy minicolumns (Qiagen, Redwood City, CA). RNA was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissues were homogenized using a TissueLyser (Qiagen, Valencia, CA, USA). Subsequent RNA isolation and cDNA synthesis were performed as described previously (Keppner et al ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... A Qiagen QIAamp DNA Micro Kit (Qiagen, Valencia, CA, USA) was used for extraction ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were lysed in QIAzol Lysis reagent (Qiagen, Valencia, CA) and total RNA was extracted using the miRNeasy mini kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... These were then homogenized in QIAzol reagent (Qiagen, Valencia, CA) for total RNA isolation and used for miRNA sequencing ...
-
bioRxiv - Genomics 2020Quote: DNA was extracted using a DNeasy PowerSoil kit (Qiagen, CA) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Then 450 μL of Buffer RLT (Qiagen, Valencia, CA, USA) supplemented with B-mercaptoethanol (1% ...
-
bioRxiv - Genetics 2021Quote: ... then purified using the RNeasy kit (Qiagen, Valencia, CA, USA). RNA was shipped to the UCSD Genomics Core Facility where libraries were prepared from total RNA with RIN score above 8.7 ...
-
bioRxiv - Microbiology 2020Quote: ... and purified using the Qiagen Miniprep kit (Qiagen, CA, USA). The synthetic community was formed by combining equimolar concentrations of plasmids containing the cpn60 UT for all 20 microorganisms (Links et al ...
-
bioRxiv - Bioengineering 2020Quote: ... phage DNA were isolated (QIAprep Spin Miniprep; Qiagen, Valencia, CA) and analyzed for sequence convergence by the DNASU Sequencing Core (Tempe ...
-
bioRxiv - Bioengineering 2020Quote: ... using a QIAprep Spin Miniprep kit (QIAGEN, Valencia, CA, USA)96 ...
-
bioRxiv - Physiology 2020Quote: ... Genomic DNA was removed via gDNA column (Qiagen, Valencia, CA), and RNA was isolated with an RNeasy mini prep kit (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... neurite RNA was isolated using RNAeasy Microisolation Kit (Qiagen, CA).
-
bioRxiv - Microbiology 2020Quote: ... QIAprep Spin Miniprep kit was obtained from Qiagen (Valencia, CA). Isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Neuroscience 2020Quote: The tissues were homogenized in RLT buffer (Qiagen, Valencia, CA), and 1% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... and purified using QIAquick Spin Kit (QIAGEN, Valencia, CA, USA). Purified PCR products with ≥ 25 ng/μl of DNA concentration were submitted to the Center for Research on Influenza Pathogenesis (CRIP ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted using RNeasy mini kit (Qiagen; Valencia, CA) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) using 9.5 μl of Oligofectamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) using 9.5 μl of Oligofectamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) for 72 hours prior to plating and then seeded at 2×104 cells/well in complete media ...
-
bioRxiv - Microbiology 2021Quote: ... and purified using Ni-NTA resin (Qiagen, Valencia, CA, USA). The purified proteins were desalted with desalting column (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... were functionalized with biotinylated anti-5His antibodies (Qiagen, Valencia CA) and stored with continuous rotation at 4°C in BRB80 (80 mM PIPES ...
-
miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... the miScript Reverse Transcription Kit (Qiagen, Inc., Valencia, CA, USA) was utilised for the reverse transcription of 1 μg total RNA according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... All PCR products were initially column purified (Qiagen, Valencia, CA) and most of the plasmids recovered after assembly lacked the SEC fragment ...
-
bioRxiv - Biochemistry 2022Quote: ... Ni-NTA Agarose was purchased from Qiagen (Santa Clarita, CA), and Bio-Gel P2 from Bio-Rad (Hercules ...
-
bioRxiv - Bioengineering 2022Quote: ... followed by purification Giga-prep kits (Qiagen, Valencia, CA, USA). The sequence of hGDNF cDNA can be found on web page http://www.origene.com/human_cdna/NM_199234/SC307906/GDNF.aspx ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and Qiagen MinElute spin column (Qiagen, Inc., Valencia, CA, USA). To maximize library complexity by reducing the number of DNA purification steps during library preparation ...
-
bioRxiv - Cell Biology 2021Quote: ... for miRNA-enriched fraction or RNEasy kit (Qiagen, Valencia, CA) for larger RNA fraction ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was extracted using the RNeasy kit (Qiagen, CA) and quantitated on a Thermo Nanodrop ...
-
bioRxiv - Microbiology 2022Quote: ... with lysis performed using a TissueLyser II (Qiagen, Carlsbad, CA), and bead clean-ups performed using the KingFisher Flex Purification System (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2022Quote: Cells were lysed using RLT Buffer from Qiagen (Valencia, CA) following manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... purified with an EndoFree plasmid kit (Qiagen, Valencia, CA, USA), and resuspended in 71 mM sterile PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... prepared with EndoFree plasmid MEGA prep kit (Qiagen, Valencia, CA), at the SAIC Advance Research Facility (Frederick ...
-
bioRxiv - Zoology 2020Quote: ... We used the DNeasy Blood & Tissue kit (QIAGEN, Valencia, CA), following the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and purified using RNeasy Mini kits (Qiagen, Valencia, CA, USA). Total RNA (1–2 μg ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted using Qiagen DNeasy Kit (Qiagen, CA, USA) from lyophilized tissue following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or DNeasy Blood and Tissue Kits (Qiagen, Valencia, CA, USA). We used the protocol for extracting DNA from historical museum specimens that was developed and outlined in Hamilton et al ...