Labshake search
Citations for Qiagen :
201 - 250 of 3512 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Reverse transcription was performed using the QuantiTect Reverse Transcription Kit (Qiagen). 1 μg total RNA was used in each reaction ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA was reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG) ...
-
bioRxiv - Cell Biology 2022Quote: ... After reverse transcription with the Quantitect reverse transcription kit (Qiagen, 205311), SYBR green qPCR was performed (Takyon ...
-
bioRxiv - Cell Biology 2023Quote: ... and subsequently reverse transcribed using the QuantiTect Reverse Transcription (Qiagen, 205311) kit according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... and reverse-transcribed using the Quantitect Reverse Transcription Kit (Qiagen # 205311) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was harvested from 2-3 million HIV-dreGFP infected Jurkat cells exposed to EPZ-719 (500nM) or control (DMSO) using a RNEasy kit (Qiagen). RNA quantity and quality were then analyzed by nanodrop and Tapestation (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... microdissected human brain tissue was flash frozen and lysed to extract proteins using a TissueLyser II system (QIAGEN) and total protein concentration determined using the Pierce BCA protein assay kit (Thermo Fisher Scientific 23225) ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Zoology 2021Quote: Nucleic acids were extracted using a QIAamp MinElute Virus Spin Kit (QIAGEN) and used to construct the sequencing libraries ...
-
bioRxiv - Plant Biology 2021Quote: ... Virion DNA was isolated using QIAamp MinElute Virus Spin Kit (Qiagen, Maryland).
-
bioRxiv - Immunology 2022Quote: ... To sequence the envelope from serum virus we isolated viral RNA (Qiagen), synthesized cDNA ...
-
bioRxiv - Immunology 2020Quote: Plasma RNA was extracted using the QIAamp MinElute Virus Spin Kit (Qiagen) along with a DNaseI (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR of SIV gag RNA was by QuantiTect Virus kit (Qiagen 211011) or ddPCR using One-Step RT ddPCR Adv kit (Bio-Rad 1864022) ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR of SIV gag RNA was by QuantiTect Virus kit (Qiagen 211011) or ddPCR using One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad 1864022) ...
-
bioRxiv - Microbiology 2023Quote: ... and recLI9-NS1-GFP11 reporter virus was purified using RNeasy kit (Qiagen). cDNA synthesis was performed as above using random hexamer primers (25°C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen). Then ...
-
bioRxiv - Molecular Biology 2021Quote: ... and reverse-transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). E1^E4 transcripts were detected by PCR ...
-
bioRxiv - Immunology 2021Quote: ... RNA was reverse transcribed with the QuantiTect reverse transcription (RT) kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and reverse transcription was performed with the Quantinova reverse transcription kit (Qiagen); reaction mixtures lacking reverse transcriptase was used as negative control ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA was reverse transcribed to cDNA with QuantiNova Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... and reverse transcribed using a QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) and a BioRad S1000 thermal cycler (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen, Venlo, Netherlands) according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription was performed via the miScript II reverse transcription kit (Qiagen). qPCR was performed using the RotorGeneQ thermocycling system (Qiagen ...
-
bioRxiv - Physiology 2022Quote: ... RNA was reverse transcribed to cDNA using QuantiTect Reverse Transcription Kit (Qiagen).
-
bioRxiv - Developmental Biology 2022Quote: Reverse transcription was performed using the QuantiTect® Reverse Transcription Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse transcription was performed using a QuantiTect Reverse Transcription Kit (Qiagen, 205311) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... and reverse-transcribed using a QuantiTect Reverse Transcription Kit (QIAGEN cat:205311). cDNA from each independent biological replicate was plated in triplicate and run on a 7900HT Fast Real-Time PCR System (Thermo ...
-
bioRxiv - Pathology 2021Quote: ... Reverse transcription reaction was performed with the miScript Reverse Transcription kit (QIAGEN), and cDNA was amplified by real-time PCR with a miScript SYBR Green kit (QIAGEN) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse transcription was carried out with QuantiTect Reverse Transcription Kit (Qiagen) with indicated primers (Table 3 ...
-
bioRxiv - Microbiology 2022Quote: ... and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen). RT-qPCR samples were run in duplicate on the StepOne Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Bioengineering 2023Quote: ... before reverse transcription into cDNA using QuantiTect Reverse Transcription Kit (Qiagen, Germany). qPCR was performed with PowerTrackTM SYBR Green Master Mix kit (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse-transcribed to generate cDNA using QuantiTect Reverse Transcription system (Qiagen). Primers for real-time RT PCR (F ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg of purified RNA was reverse transcribed using RT2 First Strand Kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg of RNA was retrotranscribed in cDNA with QuantiTect Reverse Transcription Kit (Qiagen), followed by a PCR amplification of the subsequent transcripts ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was prepared from 1 μg RNA using a Quantitect Reverse Transcription kit (Qiagen) and diluted 1:20 in DEPC-treated water ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNAs were synthesized from ∼1 µg total RNA using QuantiTect Reverse Transcription kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2022Quote: Reverse transcription was carried out using the miRCURY LNA™1 RT Kit (Qiagen) using 10 ng of RNA according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg mRNA per sample was used to perform reverse transcription (Qiagen, Cat. # 205311). Gene expression levels were then detected using SYBR Green (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was prepared from 1 µg of RNA using QuantiNova Reverse Transcription Kit (Qiagen). SYBR Green I Master (Roche ...
-
bioRxiv - Systems Biology 2022Quote: RNA was extracted from the whole blood of PLHIV of the 200 HIV pilot study using the QIAGEN PAXgene Blood RNA extraction kit (QIAGEN, Netherlands) according to the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2019Quote: ... mRNA expression levels were normalized to the housekeeping human TATA-binding protein (TBP) mRNA (RT2 qPCR Primer Assays, Qiagen) in the GAL4 assay and to the human housekeeping hypoxanthine guanine phosphoribosyltransferase (HPRT ...
-
bioRxiv - Cancer Biology 2021Quote: ... and reverse transcription was performed with the QuantiTect reverse transcription kit (QIAGEN, 205313). Quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Synthetic Biology 2019Quote: ... RNA was reverse transcribed using either the QuantiTect Reverse Transcription Kit (Qiagen, 205311) according to the manufacturer’s protocols (including the gDNA wipeout step ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was performed with the QuantiTect Reverse Transcription Kit (Qiagen GmbH, Hilden) according to the manufacturer’s manual ...
-
bioRxiv - Neuroscience 2020Quote: ... and reverse-transcribed (~200ng) into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... and reverse-transcribed into cDNA with the QuantiTect Reverse Transcription kit (QIAGEN, Germany). Quantitative RT-PCR was performed as described (Liu ...
-
bioRxiv - Physiology 2022Quote: ... and reverse transcribed into cDNA with the QuantiTect Reverse transcription kit (both Qiagen). Real-time PCR reactions were run on a QuantStudio 6 Flex machine using PowerUp SYBR Green master mix (Applied Biosystems ...