Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Transfected cells were subjected to 48 h of pulsatile light activation and total RNA was extracted from cells using RNeasy Plus Mini Kit (QIAGEN) and QIAshredder (QIAGEN ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA eluted with a cocktail of 100 ug/ml RNase A and 0.1 units/microliter RNase H and samples purified with The Quick-DNA™ Miniprep Plus Kit (Qiagen). For protein elution ...
-
bioRxiv - Systems Biology 2024Quote: Total RNA was extracted from endothelial cells after stimulation with ImP (100 nM) or control for 12 h using the RNeasy Mini Kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... The complex (12 mg/ml) was screened for crystallization using the 384 conditions of the JCSG Core Suite (Qiagen) on our custom-designed robotic CrystalMation system (Rigaku ...
-
bioRxiv - Microbiology 2020Quote: ... The complex (7.5 mg/ml) was screened for crystallization using the 384 conditions of the JCSG Core Suite (Qiagen) on our custom-designed robotic CrystalMation system (Rigaku ...
-
bioRxiv - Microbiology 2019Quote: Microbial genomic DNA was extracted from the human stool samples using the DNeasy PowerSoil DNA Isolation Kit (Qiagen). The V4 region of 16S rRNA gene was amplified and sequenced using the Illumina MiSeq platform(67) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human HDL (40nM) or PBS for 48 hours prior to RNA isolation using the RNeasy Mini kit (Qiagen). RNA samples were converted to cDNA libraries by the Northwestern University Genomics Core facility and were then run on the Illumina HT-12 microarray ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free cfDNA (both human and mouse) was isolated with QIAamp DSP Circulation NA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 22 human vaginal samples using the QIAamp UCP Pathogen Mini Kit (QIAGEN, Venlo, Netherlands) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA from murine or human monocytes was isolated using AllPrep DNA/RNA/miRNA Universal Kit (Qiagen, 80224). DNA (1 µg ...
-
bioRxiv - Neuroscience 2021Quote: The total RNA from mouse cortex and human PBMC was extracted using the RNeasy® Mini Kit (Qiagen) and real-time PCR was done as described in the Supplementary material.
-
bioRxiv - Neuroscience 2020Quote: ... RNA was isolated from human autopsy brain tissue using the RNeasy Plus Universal Mini Kit (Qiagen Cat# 73404).
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from cells or human or mouse brain tissues using RNeasy Mini kit (Qiagen, 74106). Reverse transcription was carried out using iScript Reverse Transcription Supermix (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from the human biopsy samples and mice colon tissue was isolated using RNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human myeloma cell lines were authenticated by subjecting genomic DNA isolated with the QIAamp DNA Mini Kit (Qiagen), and short tandem repeat (STR ...
-
bioRxiv - Neuroscience 2023Quote: ... Bulk gDNA and RNA from human retinal organoids were isolated using the AllPrep DNA/RNA Micro Kit (Qiagen) or DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from human glioblastoma cells using the RNeasy kit according to the manufacturer’s instructions (Qiagen). RNA quality was assessed on a Bioanalyzer (Agilent ...
-
bioRxiv - Pathology 2023Quote: Total RNA was extracted from the frozen human stomach tissues using the RNeasy plus Mini Kit (Qiagen, US) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was collected from treated human or murine primary spinal cord astrocytes using an RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Primary human Fibroblasts were washed with PBS before total RNA extraction using the RNeasy Plus Mini Kit (Qiagen).
-
bioRxiv - Genomics 2024Quote: Genomic DNA from human CD34+ cells from three normal adult donors was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: RNA from human cell cultures was extracted from 6 well plates using RNeasy Plus micro kit (Qiagen, 74034). The plates were washed once with PBS ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted from human CSF samples using the PAXgene® Blood miRNA kit (Pre-Analytix, Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Luciferase reporter constructs were either mock-treated or methylated in vitro with SssI CpG methyltransferase for 4 h at 37 °C and purified with the QIAquick Purification Kit (QIAGEN 28704). Reporter plasmid (500 ng ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was prepared from HT29 cells treated with 10 mM BG for 48 h utilizing RNeasy Mini kit (Qiagen, Germany), and was subjected to microarray and RNA sequencing analyses as described previously (Sasaki et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... After incubation at 37°C for 22 h samples were filtered using a 30 µm CellTrics strainer and purified using the QIAquick Gel Extraction Kit (Qiagen, 28115). DNA concentration was measured with a Qubit Fluorometer (Thermo Fischer ...
-
bioRxiv - Microbiology 2021Quote: ... we collected the cell culture supernatants after 24 h of infection for viral RNA extraction with a QIAamp 96 Virus QIAcube HT Kit (Qiagen, 57731) and for viral RNA copy number detection in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed three times in PBS at 48 h prior to RNA extraction using a RNeasy plus Micro Kit (Qiagen, 74034). Eluted RNA was quantified using Qubit Fluorometer 4 (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: Total RNA of the supernatants collected from SARS-CoV-2 infected Calu-3 cells 48 h post-infection were isolated using the QIAamp Viral RNA Mini Kit (Qiagen; #52906) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Microbiology 2020Quote: ... adjusted to pH 8.0 using 1M Tris-HCl pH 8.0 and incubated at room temp for 1 h with Ni-NTA Agarose beads (Qiagen). Beads were washed twice with PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Physiology 2022Quote: ... Lysates were centrifuged at 100,000 x g for 1 h and the supernatant were affinity purified on Ni-NTA resin (Qiagen) by batch binding for 30 min-1h ...
-
bioRxiv - Microbiology 2024Quote: ... DNA on the exterior of filtered capsids was digested for 1 h at 25°C with 20.3 units DNase (79254; Qiagen) supplemented with 10 mM MgCl2 ...
-
bioRxiv - Biophysics 2021Quote: The nsp10:16 protein complex was supplemented by 1 mM sinefungin Crystals of the nsp10:nsp16 protein complex grew in three days in commercial JCSG I-IV screens (Qiagen). They were cryo-protected in mother liquor supplemented with 20% glycerol and flash frozen in liquid nitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Crystals of SB16-RBD and SB45-RBD complexes and Sb16 alone were observed within one week using Protein Complex (Qiagen) and Wizard Classic 4 (Rigaku) ...
-
bioRxiv - Biochemistry 2023Quote: ... and the complex of RAD51 and MBP-BRCA2 BRC4 was purified from clarified lysate through consecutive amylose and Ni-NTA (Qiagen) affinity chromatography ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 U/μL RNase H (QIAGEN, Düsseldorf, Germany)] ...
-
bioRxiv - Microbiology 2024Quote: ... after 4 h of coculture (Qiagen, Montreal, Canada). Reverse transcription of isolated RNA was performed using the Maxima First Strand Kit (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: Cells from planktonic and biofilm fractions were collected at 48 h and extraction of DNA was performed using a commercial kit (DNeasy PowerBiofilm, Qiagen, Mississauga, ON) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Bioengineering 2021Quote: Total RNA content of 3-4 biological replicates of control and samples treated with TNF-α at 40 ng/mL for 24 h were extracted using the RNeasy mini kit (QIAGEN, 74134) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Plant Biology 2023Quote: ... and pXVE::YFP-cPMEI8 plants treated with control MS and 5 µM estradiol for 24 h using the RNeasy Plant Kit (QIAGEN, Hilden, Germany). For RNA isolation from meristematic and elongation zones ...