Labshake search
Citations for Qiagen :
201 - 250 of 3717 citations for 4 Methoxy 2 3 3 4 5 Pentacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant was then incubated with 3 ml of Ni-NTA Superflow agarose beads (QIAGEN), which were preequilibrated with bacterial lysis buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Genomics 2022Quote: ... 50 ng of total RNA was processed up to 3’ adapter ligation step according to the manufacturer’s instruction (Qiagen). The adapter-ligated RNA was treated with 5U of RppH (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... An RNase step was performed using ribonucleases A (25 ug/ml) (Qiagen) and T1 (25 units/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were centrifuged at 16,000 g for 5 min and supernatant was treated with 4 µL of RNase A (100 mg/mL) (Qiagen Singapore Pte. Ltd, Cat. No. 19101), gently mixed by flicking of tube and incubated at room temperature for 2 min ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was collected and incubated with 4 ml of Ni-NTA agarose (Qiagen) for 2 hours at 4° C ...
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... 50 µL of saturated bacterial cultures were extracted using a DNeasy UltraClean 96 Microbial Kit (Qiagen, 10196-4).
-
bioRxiv - Genetics 2020Quote: ... suspended in 1 mL of (v/v) 50% ACN and homogenized in a bead mill (50 Hz, 5 min; TissueLyser LT, Qiagen, Germany) using two 5 mm tungsten balls ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... Transcripts were stabilized by mixing 3 mL of cell cultures at the mid-log phase with 6 mL of RNAprotect Bacteria Reagent (Qiagen). Samples were immediately vortexed for 5 sec ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Microbiology 2020Quote: ... and supplemented with 1X EDTA and 1X Halt Protease inhibitor cocktail (Thermo-Scientific, CAT No.:78440) and were lysed using bead beating (50 Hz for 3 five-minute cycles, TissueLyzer II (Qiagen) with 0.1 mm silica beads) ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Microbiology 2022Quote: ... The soluble extracts were mixed for 30 min with 3 ml of Ni2+-NTA-agarose (Qiagen) that had been equilibrated with buffer A containing 10 mM imidazole ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was added to 3 ml of Ni-nitrilotriacetic acid (NTA) superflow resin (Qiagen) and the mixture was applied onto a gravity drip column ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 99% Buffer TCL (Qiagen, cat# 1031576), sealed with perfluorinated oil (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Biochemistry 2024Quote: Total RNA was isolated from bacterial cells using the RNeasy mini kit (5 mL culture) and RNeasy maxi kit (50 mL culture) (Qiagen). RNA concentrations were measured using a Nanodrop spectrometer (ThermoScientific) ...
-
bioRxiv - Microbiology 2023Quote: ... then 50 mg transferred to 2 ml Plant Pro tissue disruption tubes (Qiagen Ltd, U.K.). DNA was extracted following manufacturers protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The soluble cell lysate fraction was loaded on a 4 mL Ni-NTA column (QIAGEN) pre-equilibrated with binding buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatant was added to a gravity column containing 4 mL of Ni-NTA (Qiagen). Beads were washed with a high salt buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... to which 4 μL of RNase A (100 mg/mL) was added (Qiagen, Germantown MD). The cell lysate was applied to a DNeasy Mini spin column ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 50 nM double-stranded siRNA oligonucleotides (Supplementary Table 3) using HiPerFect Transfection Reagent (Qiagen, Crawley, UK).