Labshake search
Citations for Qiagen :
51 - 100 of 3717 citations for 4 Methoxy 2 3 3 4 5 Pentacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Cleared lysate was briefly incubated (approximately 5 min) with 3 ml Ni-NTA Agarose (QIAGEN) before flow-through was collected ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Four 2-mL aliquots of culture were thoroughly mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) and incubated at room temperature for 5 min before centrifugation at 4,000 × g for 12 min at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... RNA was pooled from 3-4 wells of an MEA plate and then extracted using the miRNeasy kit (Qiagen). RNA levels were measured using the nanoString nCounter® PlexSet™ (nanoString ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3 min at 50 Hz using a TissueLyser LT (Qiagen) with 1 min incubation on ice in between homogenisations ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... a 19-mer SPRY2 target sequence (5′-AACACCAATGAGTACACAGAG-3) (QIAGEN) was used and for the control a 19-mer NSi control sequence (QIAGEN ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Cancer Biology 2021Quote: ... a cancer associated fibroblast (CAF) cell line (pCAF2) expressing TGF-β responsive SMAD2/3/4 RE-Luciferase (Qiagen, #CLS-017L) was created ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: Genome DNA was extracted from each cell line every 3 – 4 days after transfection or transduction using DNeasy Blood and Tissue Kit (QIAGEN) per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was incubated for 2h at 4°C with 5 ml of Ni-NTA agarose (Qiagen) pre-equilibrated in wash buffer 1 WB1 ...
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: ... ~2×108 cells/replicate in late exponential and ~4×108 cells/replicate in stationary phase were incubated with RNAprotect Bacteria Reagent (Protocol 3, Qiagen, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from NPCs and their derived astrocytes (4 lines, n=3 per cell type) using a RNeasy mini kit (Qiagen, 74104). RNA samples were prepped using TruSeq® Stranded mRNA Library kit (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was isolated from 16 placentas (3-4 placentas/fetal sex/group) using an RNAeasy kit (Qiagen, Venlo, The Netherlands). Isolated RNA was stored at −80 °C in nuclease-free water ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...