Labshake search
Citations for Qiagen :
201 - 250 of 2820 citations for 1 Piperidin 4 yl azetidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Neuroscience 2024Quote: ... using a 3 mm bead (Qiagen 69997) and agitation with the Tissue Lyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were extracted using the AllPrep DNA/RNA Micro kit (Qiagen) for simultaneous purification of minute amounts of DNA and RNA from the same sample without making use of the carrier RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... the resulting supernatant was incubated with nickel-nitrilotriacetic acid agarose beads (QIAGEN) pre-equilibrated with the washing buffer (20 mM HEPES ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was incubated with Ni-nitrilotriacetic acid (NTA) resin from Qiagen for 1hr at RT ...
-
bioRxiv - Zoology 2021Quote: Nucleic acids were extracted using a QIAamp MinElute Virus Spin Kit (QIAGEN) and used to construct the sequencing libraries ...
-
bioRxiv - Microbiology 2020Quote: ... then the nucleic acid was purified using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Viral ribonucleic acid (RNA) was extracted by viral RNA kit (Qiagen, Germany), reversed by reverse transcription kit (Promega ...
-
bioRxiv - Biochemistry 2022Quote: ... Ni(II)-nitrilotriacetic acid agarose (Ni-NTA) resin was purchased from Qiagen. L-Allylglycine was purchased from Cayman Chemical Company ...
-
bioRxiv - Molecular Biology 2022Quote: ... the His-SUMO conjugates were enriched using nickel-nitrilotriacetic acid beads (Qiagen). Upon multiple washing steps ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 µL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by purification using nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (QIAGEN). The recombinant protein was desalted with PD-10 column (SephadexTM G-25M ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted with the QIAamp Viral RNA mini kit (QIAGEN) to be further randomly amplified using a modified Whole Transcriptome Amplification 2 (WTA2 ...
-
bioRxiv - Microbiology 2021Quote: ... the supernatant was extracted with a nickel-nitrilotriacetic acid-agarose suspension (Qiagen) or a Pierce GST Spin Purification Kit (Thermo ...
-
bioRxiv - Biophysics 2023Quote: ... GlpG in supernatant was purified using nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) affinity chromatography in 50 mM Tris-HCl buffer (pH 8.0 ...
-
bioRxiv - Biochemistry 2024Quote: ... Nickel-nitrilotriacetic acid (Ni-NTA) resin was obtained from Qiagen (Valencia, CA). Stain free gels (4-12% ...
-
bioRxiv - Bioengineering 2024Quote: ... the supernatant was incubated with Ni-nitrilotriacetic acid (NTA) agarose resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins (2 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μL of dry nickel-nitrilotriacetic acid-agarose (Ni-NTA) beads (QIAGEN), were equilibrated with Guanidinium buffer supplemented with 5 mM β-mercaptoethanol and 50 mM Imidazole pH 8.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted using nucleic acid isolation kit (AllPrep® Qiagen) according to protocol instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Biochemistry 2023Quote: ... the clarified supernatant was incubated with nickel-nitrilotriacetic acid agarose resin (QIAGEN) for 3 hours at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Monovalent IgG was further purified by Ni- nitrilotriacetic acid (Ni-NTA) (Qiagen) column and then size exclusion column (superdex 200 ...
-
bioRxiv - Genomics 2024Quote: ... Nickel-nitrilotriacetic acid (Ni-NTA) resin was obtained from Qiagen (Valencia, CA), and stain-free gels (4-12% ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 µl of diluted template cDNA (1:3, nuclease-free water) per real-time PCR reaction (10 µl – SYBR Green PCR kit, Qiagen, 204143) was used to assay specific transcript abundance (CFX96 Real-Time System ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from homogenized lysate containing a range of 3×103 to 1×105 cells per sample using a ll Prep DNA/RNA Mini kit (Qiagen, #80204). RNA was purified and concentrated using RNAClean XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).